--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13797 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        618        790   1   Terminal    173    73        Good
agtggtgggattacaggcgtgagccactgtgcctggcctcctttttatttttttcactga
acaaaccatgaaactttcccagatgtaaatatctatttcccatttttctttttttaaaat
aaggcattattttaaccatttgagtgttagatattatttttagataatattttaatttag
GCATAACTGCCGTGCAAAATCTGAAGATTAATATCTACCTTGTGAGTCATTCCTCTGTGA
GACAGTGCATGTTAAATATGTTGAATTGGCAGGTGAAAAAGGAAGAAAAAATGAGTAGTG
ATTGGTTATCCACAGCTATGAATGAGAAATTGAAGGTAGTAGACTATGGATGA
caaacctattcttggtttccttctgtttctgaaattctaattactaccacaactacatga
gagacactactaacaagcaaagttttacaactttttaaagacatagactttatgttatta
taattaaaaatcatgcatttttgtcatattaataaaattgcatatacgatataaaggcat

Exon  2 +       2241       2624   1   Internal    384    97   Excellent
caaaagagataaacaataagtcgctgtttcttcatacgtacttcttacttttgaaaagat
gagaaaagtctgggccatgtcacaaacattgccaaaaataagacaataaaaagcacagtt
gtcagagttaaaccacaacagtaccaaactctaccatttcttttctttttctcccactag
TGCTTCTCATTAAAGAGAGTGGAGCCTGGTCTTACAACACCTCCACGGAAGCTATGACTT
ATGATGAGGCCAGTGCTTATTGTCAGCAAAGGTACACACACCTGGTTGCAATTCAAAACA
AAGAAGAGATTGAGTACCTAAACTCCATATTGAGCTATTCACCAAGTTATTACTGGATTG
GAATCAGAAAAGTCAACAATGTGTGGGTCTGGGTAGGAACCCAGAAACCTCTGACAGAAG
AAGCCAAGAACTGGGCTCCAGGTGAACCCAACAATAGGCAAAAAGATGAGGACTGCGTGG
AGATCTACATCAAGAGAGAAAAAGATGTGGGCATGTGGAATGATGAGAGGTGCAGCAAGA
AGAAGCTTGCCCTATGCTACACAG
gtagggagtttgcggcagcagtgggaggtagtttcagtgtgtgggcatcttggcaaattt
acagcatgcaaaaactgctctctattgtggtcattttatgttccaaaagattctgtttaa
ctgctaaagtttctctcttttgctgttttgtgtgaatgtgggcaagaatatgtggatatg

Exon  3 +       3297       3404   1   Internal    108   100   Excellent
aggtttaggataggtgggcctgaaactcagatttggaactttgtaaaacacttcagttaa
agtctatggcactctgtaggactgctgatgtctctgttgcacactgttgattctaaaatc
aaaggcactcagtataagcacagtaatagtcctcctcatcatgctttgtattttccgtag
CTGCCTGTACCAATACATCCTGCAGTGGCCACGGTGAATGTGTAGAGACCATCAATAATT
ACACTTGCAAGTGTGACCCTGGCTTCAGTGGACTCAAGTGTGAGCAAA
gtaagtctggttcttgcctctttcttcacttgagatggtagcaccatctcacgtcctagc
tggcattagagtcaggtctgcatgccttcccttccctggtgcagatggtgtcatatggtg
atcgtgagctgagactatgaagtcagaccctgctgggtttgagtcctagattcaccagtt

Exon  4 +       5865       6053   1   Internal    189    74        Good
atgggagcccagagccttcagtgtacctcatctgggaattgggacaacgagaagccaacg
tgtaaaggtagagttgttccacatggagacttactgtgaacattctttctctcaacccat
actggaaatgggcaagctaattctaggccgtgctaatatcaatgcgtatatttgttacag
CTGTGACATGCAGGGCCGTCCGCCAGCCTCAGAATGGCTCTGTGAGGTGCAGCCATTCCC
CTGCTGGAGAGTTCACCTTCAAATCATCCTGCAACTTCACCTGTGAGGAAGGCTTCATGT
TGCAGGGACCAGCCCAGGTTGAATGCACCACTCAAGGGCAGTGGACACAGCAAATCCCAG
TTTGTGAAG
gtaagcttgagatccttcgatttatactttcttaaagaacaaccatcttcaaacttggac
agtgaaaaaaaaaaccaatacccactttaactatagaaatcagatttgatgagcaaccct
cgtatctttgagattcatttaaaagaactaatgtttggccagggaaaggatcatatgtgt

Exon  5 +       6872       7175   0   Internal    304    63    Marginal
atgacccatatgttgtcctcagactgcgtgaaatctttccttggaccataatttattttg
tgtgttagaagaacagtgctcaggaactaatgttctgattaattagtcttttaattagtg
ccatgatcagtgagggggctgaaattcaaagaaaacacagccatcttcccatttgtccag
GGAATTATAAAGAATCTTCAGTTCTCCAAGTGTTGCTTGAATGAACTGGGTTCACTCAAC
AAACGCCAAGTACTCTCTAGTTCCACTGCAATATTTTCTGACCATCATTTTGATGTCTCA
GCTTTCCAGTGCACAGCCTTGTCCAACCCCGAGCGAGGCTACATGAATTGTCTTCCTAGT
GCTTCTGGCAGTTTCCGTTATGGGTCCAGCTGTGAGTTCTCCTGTGAGCAGGGTTTTGTG
TTGAAGGGATCCAAAAGGCTCCAATGTGGCCCCACAGGGGAGTGGGACAACGAGAAGCCC
ACAT
gtgaaggtacagtctttgtttttattttattttaagataaaaagaactattgaagagctt
gggaacttggttaccttgggaaacgtattgctggagatgcaaacaaacttctaaagtgct
ctctcgtgtgttccagctgtgagatgcgatgctgtccaccagcccccgaagggtttggtg

Exon  6 +       9333       9510   1   Internal    178    95   Excellent
agatgccacagagccatgcttgtgctctgattattacagaggccctgaagcatcgagttt
gcaacacttgatgaattaagtcatattgtatctggatttaatatatccttaaaagtcatt
tagtctgaattaatggttgtttgtcttttcttttgcagcaaagaaatttgttcctgccag
GTAAGTTGCATTCTTATACAAAGCATGCCATTGAACATTCCACATATTTTTCTCTCTTCA
TGTTGGAAGACAGTGCTTTACCTAGTGTTCTCATGTATTCCACAGCAGCTGCCAAAGCCT
TGAATCAGATGGAAGCTACCAAAAGCCTTCTTACATCCTTTAAGTTCAAAAGAATCAG
gtaagacttgtaaatcacaaatggttatgagagaggtatcttctctacatgctctgtttc
tccttgaaccctccaaacttgccaatatcttagggagggagcaggggagaaatcatcacc
tgggtattgttctggaaagttgctttattttttgtagaaggagaggaaagaaacggatct

Exon  7 +      10159      10211   1   Internal     53    80        Good
caggtgcctgccaccacacccagctaatttttgtatttttagtagagattttgtattttt
tcgtcatgttggccaggctgatcttgaactcctgatccacccgccttggcctctcaaagt
gctgggattacaggcgtgagccactgggcctggcctgttactttatttcttatcacacag
ATGAAGAAAATGAGACAGAGAAGTTAAGTAAATTGTCTGAAATCTCAAAGCTA
gtaagtggtgtagccaggattcaaactctggcagtctggttctaaaatttgtgttcttaa
ctactccgacctgctttgagagaatttggaaaggtcaagtccctctgaatactttttaaa
aaattaaaataactttttttgtgtgtgcggttttaagtttacagaaaaattgagcagaaa

--------------------------------------------------------------------------------