--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14979 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1356   0    Initial    156    89        Good
aggcgttcccgcaggccaggagggagagggctccagggctcggcttccctggggcgggga
atcccttgccctgtcccgaggcgcaggggcggggccggggggcgcccctgacgcggcggc
tgaggtgttcccagcccggtgtcgttccccgcggtaggtggtccccgacgagctgcagcc
ATGGGAAACACCACCAGCGACCGGGTGTCCGGGGAGCGCCACGGCGCCAAGGCTGCACGC
TCCGAGGGCGCAGGCGGCCATGCCCCGGGGAAGGAGCACAAGATCATGGTGGGGAGTACG
GACGACCCCAGCGTGTTCAGCCTCCCTGACTCCAAG
gtaagcgtcccatgcccgcagttggtgtcagtactgcagcgggttgatttctgggctcct
cttccctttcttggttcttttctaccgcgccgaaccgggctatggttttttgaattaaag
ggatttatcggggacagaggtgttggatgataattcctcttgaagtgccgcctcaaaata

Exon  2 +       1827       1923   2   Terminal     97    58    Marginal
tggctctcttccatagcgttgctgaatttgtagtttgtaatccctggtggacaacttcag
agggtaggttgcacgagttgctgaccataggtggtagtttctcacctttgccctgaggtg
gctaaatgaaattctttttctgaaaatttctatgtatcagtatcatttttgctcttctag
CAGCTCTACAGTTGTGATCCTCTTCCCTTTTGGCACGGCTGTAAGCAGCAACTACTTGCT
TATTGAATACTTTCTCCTAGTCTTGGGGATCAATTAA
ggacatcatttagttgactgcttaatttttgtcccatactttatagttgtggtggctgag
gctgtgcctctttcacgccccgctgctgctccgtaggtggaagagccaatgattccacga
cttgtttactcctcagtagtacttcaaaatgttgcgtggctaaaaaaacgacaacccaca

Exon  3 +       2020       2258   1   Terminal    239    69    Marginal
gtgatcctcttcccttttggcacggctgtaagcagcaactacttgcttattgaatacttt
ctcctagtcttggggatcaattaaggacatcatttagttgactgcttaatttttgtccca
tactttatagttgtggtggctgaggctgtgcctctttcacgccccgctgctgctccgtag
GTGGAAGAGCCAATGATTCCACGACTTGTTTACTCCTCAGTAGTACTTCAAAATGTTGCG
TGGCTAAAAAAACGACAACCCACAGCTGCCCTGAAGACCTTGCTCTCAATTCCAAGGACT
TTCAGGAAGAGAACAACTTGTTTTCACTCTGTAAGAAAGGACAGATGGAGCTGATAGCAG
CGATTACCATTCTAATGTTTCTAATGGCTTTCAGAGCTGTCAGCATGAAATACAAGTAA
ttcctccaggtagactgactggatgagatagaaaaatggagggcttgaggagattcgggt
gtgtttgatgtttcctatcatttcatcacttcccagggaactggggctttagagagtgaa
tagagtattgtttgccatattggtagcacatggaatttggattccatgatttatttcttt

Exon  4 +       5412       5578   0   Internal    167    92   Excellent
tttttggtcctagatgagttctttttctataatttgttcaaactctgatttagttgctaa
ttttggggtttatatccttagccaaagcctagcacccttctctatcctagggaggagagt
gacctttttagaattcttgggtcacagtttattctagggatgacctactccttcttacag
CTCCCTGGGGACAAAGAGTTTGTATCATGGCAGCAGGATTTGGAGGACTCCGTAAAGCCC
ACACAGCAGGCCCGGCCCACTGTTATCCGCTGGTCTGAAGGAGGCAAGGAGGTCTTCATC
TCTGGGTCCTTCAACAATTGGAGCACCAAGATTCCACTGATTAAGAG
gtgacaagtgtcttggttgaatctaagggtccaggaatagagacctgatttcttttctca
gaagagagacccagctggacttttctccacctactaaggactgtctctagaacatgccct
tttctgcggccacttagtatatctgtgggatttttttttaacctcatagtgagtcagaga

Exon  5 +       6406       6499   2   Internal     94   100   Excellent
tacatgtccaagatgatacagaaaaggagaatgggtttatacgttgttttttacaccagg
ggatacaatggcttaggaatctgggaaattattcatatgatactatgattgccacttgtt
ttttagattcagtcttctaaaaggaacttggcctgtttgcctttcttttttcttctgtag
CCATAATGACTTTGTTGCCATCCTGGACCTCCCTGAGGGAGAGCACCAATACAAGTTCTT
TGTGGATGGACAGTGGGTTCATGATCCATCAGAG
gtaaggccttgatctccaagggtaaccattgacttagcagtctcattttagctgtcattt
ctgtcaagactgatgggcagctgctcccctacactggaggatttctctcttgataaaacg
tggaggtgctgagaacaatcgtgtaaattttagtaaaagaggaaggttggatggaagaga

Exon  6 +      11565      11633   0   Internal     69    87        Good
aattttctgtaataggattgtattattgatacatactagagtgggtgcattattgaaaag
agatagcgcattctagtttaaatttctcaaagagctctgaggaagagtaagctgtttggt
ttgtctgtgcattaatttcatttagtaatttttttagtaatttttttctctttctcttag
TGTGACCCAGCCTTACTCCCTGAGCCCAACCATGTTATGCTGAACCATCTCTATGCATTG
TCCATTAAG
gtaagtggtggccctggctcttcacagagctccctggaatgagaggtcaagggtaacata
cgttctcagtggttactttctctgctatttcattgaagctgaagctggcagtaatgatca
aattatagaagaactctcttttttttaactactaggttgtttgttttaaaatctcagtct

Exon  7 +      13703      13780   0   Terminal     78    84        Good
ccaaggccacaagtagaatgatgataggagtcagaattggaactaaaacttatttgacct
cctgctcttatatcaaactatctctgttaaaagtgagtgactgtgaaggactgatgactg
ggaagagctacctactgtctgaagtaatgaattagctgcgtatgtttcttttccttgcag
GACAGTGTGATGGTCCTTAGCGCAACCCATCGCTACAAGAAGAAGTATGTTACTACTCTG
CTATACAAGCCCATTTGA
agggatcccttcttgcctctaaggattcaggagaagcatctcccttgcatttctggactg
aaccagtcttacctgagactggaaggctgatttgctttgaggctgatatgtgtgtttcag
agcctctgagtaggatgctctgcttttgcatttgattgcagatgagagctttatgagttc

--------------------------------------------------------------------------------