--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13860 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1228       1346   0   Internal    119    86        Good
cgcccagccccgccccgccccgcgcccagcccagcccccgcggcccggcccccagcggcc
ggcctcccgcggccccgcccccgccgccccagtccccgcccctcgcgccttcgtttattc
ctccgcgcgctgggacaggctgcttcttcgccagaaccaaccggttgcttgctgtcccag
CGGCGCCCCCTCATCACCGTCGCCATGCCCGGAGGTCTGCTTCTCGGGGACGTGGCTCCC
AACTTTGAGGCCAATACCACCGTCGGCCGCATCCGTTTCCACGACTTTCTGGGAGACTC
gtaagtggccaccgcgtagccctgtcctggcctcggttgcgccggactcggaggtgcctt
ccctgtttcttctccctgccgtcctcccggccgctcagccccctgcgccgccctcgcctt
cccccgcactggttccggcgcgcgccaggccgtgtggcctctgctcagcgtcggctgcgc

Exon  2 +       2276       2316   1   Terminal     41    88        Good
tccagaacttgcaacacttggagggaaggactttctgacgctgttccgctggagtggcct
attcttgctagtgatggccgttccaggctccaggacacgtgtactccccaactttgagac
tctcttgttttccagtggcttgcccctcactgtcccctccgctttctaccttgcttctag
CACATGAGCTTGCTGATGATAGCCAAATTGATGACCTGTGA
tctgacttggcagttttaccattatggataggagtagtaaatcggtgttgcccttttttt
tttttaacagctcctgaatcagcaaactggaagttgcttagttttcatcagaagcattcc
aggcatgtctagttatattatggttctggagtactagtggtcccactacactgtggggct

Exon  3 +       5180       5336   2   Internal    157   100   Excellent
ctctggaggtaagtagattgaaaagcactcctcaacagaaaagcttaaaagtaaatatca
tcataagcattcatttaaaaaagaaagcctgtttttgatccagaagttgtgacttttcat
tctctgtgatgttggtgataactcttaattcaattgtgaccttgtttttcttcctttcag
ATGGGGCATTCTCTTCTCCCACCCTCGGGACTTTACCCCAGTGTGCACCACAGAGCTTGG
CAGAGCTGCAAAGCTGGCACCAGAATTTGCCAAGAGGAATGTTAAGTTGATTGCCCTTTC
AATAGACAGTGTTGAGGACCATCTTGCCTGGAGCAAG
gttagtatcaattggcatgtgctttgagcctgagattataggtcaagttataaattatgg
agtacttggttttgaggttaaggtacaagtaagccttaggttcaaagttcactaattatt
tgaaaatttcagttgaaccacacagtgatcacattgctaaatccattggtcagtcaattc

Exon  4 +       9215       9361   0   Internal    147   100   Excellent
cctggcaataattggaatgaagagtgttcatctactcactttttaaaattaaaattgctt
aaagaaaattactgtgatttggtcctctttcctgtcttgcaaggtgatggctgttaactg
atgaaattcagagcatgtgttgggtttagattcctctttccccttttacttgtgtttcag
GATATCAATGCTTACAATTGTGAAGAGCCCACAGAAAAGTTACCTTTTCCCATCATCGAT
GATAGGAATCGGGAGCTTGCCATCCTGTTGGGCATGCTGGATCCAGCAGAGAAGGATGAA
AAGGGCATGCCTGTGACAGCTCGTGTG
gtaggtcatacaaattcattttgtagttagcttaactgatcaggctgtatgtccgtgtaa
atgctggtaccagctagaggagataggggaatatctacgattatgaaataactgtgtatt
ggcgacaatatcactgattatctgtaatgctgatgcaattttcagctaaattttccaact

Exon  5 +      10109      10255   0   Internal    147    88        Good
gggagaagaaaattatctgtattccagccatccacattagcagttggtgtatccttctag
atgctttgtttttgtcttgtttttatacccttgaacattattaatgactgcagagctttc
taagtggctttaataacactcaaagaactcttcctatttatgcccctctgtgctttacag
GTGTTTGTTTTTGGTCCTGATAAGAAGCTGAAGCTGTCTATCCTCTACCCAGCTACCACT
GGCAGGAACTTTGATGAGATTCTCAGGGTAGTCATCTCTCTCCAGCTGACAGCAGAAAAA
AGGGTTGCCACCCCAGTTGATTGGAAG
gtaaagatgtttttaaaaagcagtttctctacttgcctgaagggccagtctctaaatggc
caacttcaaggtctgtgttacctgtttctagcacgcaagtacactgggaggatttttcct
catggctgagttcaagatttgctgaaaggcccttttcaaggtctttataacaccttttat

Exon  6 +      11005      11199   1   Internal    195    69    Marginal
atcacttaaattctgtatccactagttaacttattattacttatttatgtacttattgag
cccagatagtagtgaactggggagatagcagtgaataatagaaagtccttgccctcatag
aacttccattccagtgagtggagacaaacagtaaacaagtttattaagtggtgataacag
GTGCTACAGGGAAGAATCAAGCACAGATGGGGAGAATAACAGCACAGGGGTGGGAGAGTG
ACTGTCAAGGAATGCCTGTCTATGAAGGGACCTTTGGAGAAAAACACAGAGAAGATGTGA
CCAAGGCATGTATACTTGTGAGGGACGAGCACTATAGGCAGAAGGAGCAGTTAGTGCAAG
AAACTGGGCCTACAA
gtgagcttggcatgttggaggaatacaaggaaagctagcatgcttggagaagaagctgca
gaaggtggggtgagggacaagagatgagaggaggcaggattccatcacacagggcttgca
ggccatgatactcagaattaaatgtaaagtgtggtggccagctgttactgggtttaaaac

Exon  7 +      11589      11717   0   Terminal    129    92   Excellent
tgctttcctgccaaaagtgccaaagatcaacttggaaaacaaaatcctcacagaggggag
agtaaagaacacttgattagtctcattagcacctgtagctacttttctaaagttaattcc
tgaaggccttgaagcttcactatgagattgaatttcaccattctcaatgtctttcaatag
GATGGGGATAGTGTGATGGTCCTTCCAACCATCCCTGAAGAAGAAGCCAAAAAACTTTTC
CCGAAAGGAGTCTTCACCAAAGAGCTCCCATCTGGCAAGAAATACCTCCGCTACACACCC
CAGCCTTAA
gtctcttggagaagctggtgctgtgagccagaggatgtcagctgccaattgtgttttcct
gcagcaattccataaacacatcctggtgtcatcacagccaaggtttttaggttgctatac
caatggcttattaaatgaaaatggcactaaaagtttcttgagattctttatactctctgc

--------------------------------------------------------------------------------