--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (122625 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (34 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1451       1508   0    Initial     58    75        Good
aagacttagttttacagtacatctgaaagtaggagttttcagaagtatggctcttgggat
aaatttagattcttaattgtgaagctctgttaccacttgttagaaggcaggtcagctcac
ctgcttggggaggtaaatatatgaatgcactctcgagtaatttaatggagccctacctca
ATGTACAGAATGACAGTATCACAGATCAAGAATGGAGTACGAGTGATTTTCGGCTATG
gtgggggtaggtaggtcacttgtcccctgttgtctcttactatttgtaaagtgaagacta
tgattagtctttttgatcgggatggtttgagatgaataaagaataggcaggcaatttgga
tactttaggcttttcaagaacattagtaacattttttcttagatatttctcctaatacaa

Exon  2 +       3497       3617   1   Internal    121    82        Good
taaaaaaaaaaaaacttaataaaatcttcggagaagacctatagaatcttgtagtaatat
aagtgtgcctgacaccgtagcaaaagagtttaagttgtcattttatctattatgacttcc
agttttgctttaggttgttcacctgtgaattcaggaagcctccccaccatttatgtgcag
GTTGTATGGAAAATGAAAAGAGCTTCGAGCAGCTCCTTGTAAGATGCCTCTGTTGCTCAG
AGAGTCTTCATGTGAGACATGAAGACTTTGGTGCCAGGACCACTACCCTGCCCGTGCTGC
T
gtagtgttcttccgcttttcaggaaattcacaaatcttttgcaggattcctagacatctc
ttaattttaaaagtaacatctgcattggcaactccagtggaaaaatagtacacaggggtc
aactgaggattcattttgttttgggaattgtgaaatgagctatcatatggcatcttgctt

Exon  3 +      11413      11481   0   Internal     69    72        Good
gagattattatttagaaacaagtatgtcatacgcatttacaagaaataattttgtctttt
tattttactatactatgaatacatggaacatgggtttttaaagggacaatgtagctgttt
cccaacatcttttattaaaacatttgcattttactgccagttttttgttcttttcctcag
AGAGAACTCCTGGTGGCCAATGTTAGTAAATTCAACTTTCTAATTCAGGAACTTGAAAAA
CAGAATAAT
gtaatggggtctaatggtgtttacgtacaacacagtattggtaaaagaaaaagacactta
tattgcataataaggtactcaataatgctttgtatttctattaagaaagctaatttattt
cttcttaggaatgatgcagttccaaagcaaagatttgatgtcctcctaatgagtccgctt

Exon  4 +      11610      11754   2   Terminal    145    83        Good
caatgttagtaaattcaactttctaattcaggaacttgaaaaacagaataatgtaatggg
gtctaatggtgtttacgtacaacacagtattggtaaaagaaaaagacacttatattgcat
aataaggtactcaataatgctttgtatttctattaagaaagctaatttatttcttcttag
GAATGATGCAGTTCCAAAGCAAAGATTTGATGTCCTCCTAATGAGTCCGCTTTCAGTTGT
AGAGTACAGTGAAGCCCTAGCAAAGAGTAGTAAGAAATCTATTTTACTGGAGATAATAAA
TCTGACAAGGAAGCTCTCAGCATAG
attgaagttgatttggcatagagttgctttataaatagccctttcagcaaactctacagt
tctgtatgtggttttaaatccctgtaaatttgtaggcaggtacatattacaattgtctgt
ttttctttttagggttcatgtaatcaaagaagtttctttgttgtgtgtatctttacagaa

Exon  5 +      11887      11960   2   Internal     74    96   Excellent
tctattttactggagataataaatctgacaaggaagctctcagcatagattgaagttgat
ttggcatagagttgctttataaatagccctttcagcaaactctacagttctgtatgtggt
tttaaatccctgtaaatttgtaggcaggtacatattacaattgtctgtttttctttttag
GGTTCATGTAATCAAAGAAGTTTCTTTGTTGTGTGTATCTTTACAGAACACAACAGGAAT
TGAAAATGAATCAG
gtgagtttaaaaatcagaatttatacaaatacatgacctagatgttagaccagctcttga
tttttacaagatagtagcacacacattcatttctcctggattctcatttttgtttcttaa
taccattaattagttcattgtgttcataccgtgcatttgttcgtgcagtggaatgtgcat

Exon  6 +      16776      16841   0    Initial     66    61    Marginal
gtacatgcagctttatgtaacagcagccaatgccaatgttatgctgtagagcagagttac
cttgctgattacagtcaatgtttgtctaaagagtatggagagaagggctgggtagggaga
gtggaggaggttggttctgtggttcatgtacctggagcagacctgaggagggtggagtaa
ATGGTCAAAGAAGTGTGGGCTCAGCTCTGGGGTCGCCAGAAGGACAGAGTAGACTTTGCC
AGTGAG
gtggggaacctttggagggttttgaggagagggctgttagagttgagttaaaaaattctt
aataaatacaaataatgaaactattctacagggcagaatcaggacttggttactggttga
aaataataataataaaaaatagtaacttaccgtgtttcatatatgtcaggcactagccta

Exon  7 +      18543      18686   0   Terminal    144    67    Marginal
tattatttattactgttatttttcagccggtaaccatgtcctgattctgtcctgtaaaat
agtttaattactattactgcttgaattcagacccaaacatcccttctctgggctattaca
gaaagctcctgattgatttcctcgccaacgttttcctccctatgggaccattctccatag
GCCTTACAGAACATGCAGCTCACCATCTGGGAAATCAGAAAAGCCAGCGGTCGTTGCGAG
TTGTTGGGAATGTTTTCGTGGAGGAGCTGGGATTTGAACTTGACCTGGAAGGATGTGGAG
GATATTGATCGTCAGAAGAATTGA
gggccaggtgaaagtctaaattgagaaaggcccagagtagcaaggggacctaatgtggtg
agggtaggaggggccagagggtgtgccaggaacccagatgcctgtaggggccagggatga
cctgtaagagtaaaatggggatttttctgtgatttcttccaatagaatttttttttttaa

Exon  8 +      22033      22181   0   Internal    149    55    Marginal
agtcctgtgtactctttacccagccttttctagcagtaacatcttacaaagctttagtac
aatatgaaagctaggaaattgatttggtataataatgctagttagactacaggccttatt
cataaatcagaaaaatttaaaacataagattaaacaatcacacatttcataagccaccag
AATGATGACATTTTCACACATGATAGCCTCCAGAAAACTCCACTCTACACATCTGAGAGT
GAAAAAGGCAGACAACATCTTAGTGTTGTTATAGCAATAGCTCTGACCTTGTGGGCCCCA
GAAAGGGAATTCTCAGGTGTCCACGGACT
gtgaggtatgagaccccactgggttggtggttagaatgtagactctggaatctgtctgga
ttttatcttggctccactacttcaaaactatgtagcttgggaaagttactcagcagggct
gctctgtggcatagtatttgagaatccagaccctgaagcgagattgtctggattgaaatt

Exon  9 +      27346      27463   0   Internal    118   100   Excellent
gttacaaacaagcatcaaagcagctcctcaaatgcttgacatcatcgttttggtctgtct
tgccagcttcaggtttcggttacatttttgcatacttgcttattgaaccagaaaaaaaaa
aaaacccatgatttgagttttctttcttttgctgtgatccttccatttcttgacttgcag
AACACTACTGAGCCTGTGGCGGCCACCGAGACCCTGGCTGAGGTACCCGAACATGTGCTG
CGAGGACTTCCGGAGGAAGTGAGGCTTTTCCCTTCTGCTGTTGACAAGACCCGGATTG
gtgagtgctcctcctgtcacggagcaagtcaggcagtaaagagcaggtggcagtgaggct
tcctgcaggggcatgtcaggtagggagcgcaccataaaagcagcaatttacccttgactt
agaagattatatggtgttgatgcattttctagtcaagaatccaggttggacatgggttgt

Exon 10 +      29125      29228   1   Internal    104    80        Good
aaaaataaaaatccccattgaggacttgacttaatttaacttgatctcaggctattttaa
cattagcttgatttaggcagtctagccttttaactgttttgtgaaacttaagcgatttta
atggtttcaatctttaaaataaccatgatacattataaaaatactgattttattttctag
GTGTCTGGGCCACTAAACCAATTTTAAAAGGCAAAAAATTTGGGCCATTTGTTGGTGATA
AGAAAAAAAGATCTCAGGTTAAGAATAATGTATACATGTGGGAG
gtaagaagtaattctgattctttgtttttcagagttttatgaaataattattctgttctc
tcagaatttgacattttgaatttaaaacaatcattttaatgtgttctttaaagtcaagaa
tatttttattaaagagaaaatgtgtttccctggatacagactgctatttatatatgcttt

Exon 11 +      36883      36981   0    Initial     99    54    Marginal
catcactgcagtaaattaaaatgaaacttattatccctgagcccaggggcagtttatgtt
gcagatggggtaataatgtaagttactgtgtacagatactctccttggtgcctatgatga
ttaaagtaactacagtgcaccttctagcatggtacctgttacgcagtaggtgctcattag
ATGTTGGTAGTTCAGTTAACTAGGATGGTCAAGGAAGGCAGTGATACACAGAAGACAAGG
AGATCTGAGTCGAAGCCTTTCTTTATGACAATTAAACAG
gtgactttgggaaagttatttaacttttgagcctcaattttcacatgttgaaaggagagc
taataagcctgctacatagggttaaatgagataatatgtcaggcatgtagcattatgcct
gatgtttgactttcaagaggaagaaggcagtgttagggcccggtaaggtggatgctgccc

Exon 12 +      38375      38503   0    Initial    129    60    Marginal
ttttcttttctctgtcgcttgttttgtttttatgaaatgctttatatagagtacttgcat
ataatgaaaaagaattatccttaaaagttaaaaatggaggcattttaaagatactcctat
tttaacaaaagttttttacttttctccattttcaaggtgtattacccaaatttgggatgg
ATGTGCATTGATGCCACTGATCCAGAGAAGGGAAACTGGCTGCGATATGTGAATTGGGCT
TGCTCAGGAGAAGAGCAAAATTTATTCCCACTGGAAATCAACAGAGCCATTTACTATAAA
ACTTTAAAG
gtaacagcattagaattaatttactgttagttacgctgcttgtgttttcctttttctttt
tttgagacggtctcattctgtctctcaggctggagtgcaggggctccatcacggctcact
gcagcctaagcctccccagccttgggcgatcctcggacctcaacctcccgagtagccagg

Exon 13 +      45707      45833   0   Internal    127   100   Excellent
tccgggcgccggcgcggcccgcacggggccgggagcccttcctgccggccgggtgcgcgc
ggcgccgccgacagctgtttgccatcggcgccgctcccgcccgcgtcccggtgcgcgccc
cgcccccgccaacaaccgccgctctgattggcccggcgcttgtctcttctctccccgcag
CCAATCGCGCCGGGCGAGGAGCTCCTGGTCTGGTACAATGGGGAAGACAACCCTGAGATA
GCAGCTGCGATTGAGGAAGAGCGAGCCAGCGCCCGGAGCAAGCGGAGCTCCCCCAAGAGC
CGGAAAG
gtaggagccccccggcccgcccgcccggccccggcgccacgcccgcccaggacgccgccc
tgccgccctcgctgctgctggcccgaccgcgaggcgggtcgcgggctcgggcggcggcgc
ccgcggcatctcggtgaccttttccggactcggccctgccccggccccgctcccgccctg

Exon 14 +      46789      46832   0   Internal     44    54    Marginal
ttttttaatgaagaattttaatgtgaattggggaatagttcatagatcccagtttgaaaa
tatgccaaggcacagtatggttagtttcttattgatacaaatacaggtttgtgttttttg
tttttttgtttttttgttttttttttgctctccttaggtcttaagtagatttctttttag
TCATCTGAACGAACGAGTCCATCCTTTATCCAGAACATTGCAAA
gtgagttgtggaagtcatactgtaaataaaatcatatcgtaaactcgatttgggaaaatg
ttaaaatcggcattaaggaatgtaggcaagaagtctgttctgatttttcaagtatgtatt
ctttgtatgtcaccacaaaatggaaatagaattaattcccccgtgaaacagttagtaggc

Exon 15 +      48971      49136   0    Initial    166    67    Marginal
agtgtcaggtgtttcaggctattttaatgtgaaccacagaaaaattataattataaaata
gcatagaaacggtcaaatttagaagtatttctcatcttcttgatttctgtcccctgtttg
ttttggtgagaaatgagaaattgaatttgcttgttagcagtaagcaatgactgttggcaa
ATGCTCTTCCAGAGTGTAGATTATAATAGCAGAGTGTTTTCCCTGCTCTCTCAGTTACAT
AAGAGCCTTAACCTGAAGTTCTTTTACCTGGAGAAACAACAGTGGCTTTCTACAAATGGG
CTTAGTGGAAGGAATGAAAAAGACGGGATGCCTGGGCGTTTACCAG
gtgtgcgatcttggacagctcatgtcacctttctgagatgaagtttccctagccttaaaa
atgaatatcatcatatcgatgatgcttgtgccacctaacctcacaaagttgtcaagagca
agtgagataatagaaacatgctctgtgaagctgtgggctcttgggaactgtaagtaccac

Exon 16 +      50597      50711   2   Internal    115    52    Marginal
caggggtgaccattctgaggttgtgacataagtgacacaggaagttctaggggctgaggt
ctccaggaagagggacctagttctattagcagttctactcatgtagaaacctacatgagt
atttttggattatgaaactcagttctgcaaatggacatatattggccctttttctgccag
GCGCTGCACCAAGTGGCTGGGTTGGTTGGTGGGGGAGATGAGAGAGATGACTACAGCAGG
CAGCATCCTCCTCCAGTGCGGAGTCTCCAGTCCGTTTCATGACAGCCACGCACAG
gtcagacttagtgggtgttctggttgatgtgggagagaaggaaaaggacactttccaaaa
ttggataacttgtccaagatcaccctaccaatgagtgtcacagtcagaatttgaaccagt
tttcccatgccttttcttctacataatgtggagctttttgtccactcctacatgcagttg

Exon 17 +      65464      65519   0   Internal     56    77        Good
tggcatgtgagcaccttgatgcagtagataactgctgttttccttctgttgtattcaatt
tctcatcttgatgtattcatttcttttcctcatgcacatagtgttgtcctgtccctctgc
tgttccttgtcatcatttccatttcacttcccttgtgtttcattcctctttcttgtctag
ACCAAGCGGAGCAGCCAGCTGGCAGTAGCGCCCTGTAGGACCCCCAGGACCCGATG
gtaagtgcacttgtgtgcttgccaggcctcccagcggctcctgctcctctgcctcacaga
gagaagctcacaaatgccatctcccctctgtaaatgtccttatgggtttggttttttctt
ttaatttgatgacatataggacagaaatcaggtgtcagaagaaatcagtactggtttaag

Exon 18 +      65659      65769   0   Internal    111    88        Good
cagctggcagtagcgccctgtaggacccccaggacccgatggtaagtgcacttgtgtgct
tgccaggcctcccagcggctcctgctcctctgcctcacagagagaagctcacaaatgcca
tctcccctctgtaaatgtccttatgggtttggttttttcttttaatttgatgacatatag
GACAGAAATCAGGTGTCAGAAGAAATCAGTACTGGTTTAAGGAAATGTAGCAGGTTCCAC
CGCCTGTTGCTGCAATATTTGGCGGTTGTGAGGGACACCAAGCCTGTGTAT
gtgtgggcaggacccctggttctgctttctgttctgccataggctaattacttcccctct
ggcgctggccttcactttctcccacaaaattgaaggcaggacaggtgatttcaatagccc
cttcatctctagtccaaggccctcacgatgagacgtaacttaactgatggttctcatgaa

Exon 19 +      69441      69534   0   Internal     94    82        Good
ttcctttctttaggaatccaaagtggtaattgcccaggaatatacagtgttcttgattgg
attaataattatcttcagtaattcagaataacacatgagggaatgaatgaatgaataaat
aaaaaaaaaatgaatgaataaattaaaaaaaattgtgtttcagggaagaaaaaatcccag
GAAAATAAAAACAAAGGAAACAAAATCCAAGACATACAACTGAAGACAAGTGAGCCAGAT
TTCACCTCTGCAAATATGAGAGATTCTGCAGAAG
gtaagcttgtgatattggcttggtctgaattgggtgtgtatgtacccagtgaatttaact
ttgtatctctttatattgtccttctgagaatcatttaggatctttacgaggttaaacagc
aaaaaagctgcctaaatttaatgtggtaagctgagccttctatatgctaccttcccttca

Exon 20 +      76800      79181   0     Single   2382    93   Excellent
tccagcggtgtcaaacagaaggctgagggtacaggcaagactccagtccagtgggaatct
gtcttagatctcagtgtgcataaaaagcattgtagtgactctgaaggcaaggaattcaaa
gaaagtcattcagtgcagcctacgtgtagtgctgtaaagaaaaggaaaccaaccacctgc
ATGCTGCAGAAGGTTCTTCTCAATGAATATAATGGCATCGATTTACCTGTAGAAAACCCT
GCAGATGGGACCAGGAGCCCAAGTCCTTGTAAATCCCTAGAAGCTCAGCCAGATCCTGAC
CTCGGTCCGGGCTCTGGTTTCCCTGCCCCTACTGTTGAGTCCACACCTGATGTTTGTCCT
TCATCACCTGCCCTGCAGACACCCTCCCTTTCATCCGGTCAGCTGCCTCCTCTCTTGATC
CCCACAGATCCCTCTTCCCCTCCACCCTGTCCCCCGGTATTAACTGTTGCCACTCCGCCC
CCTCCCCTCCTTCCTACCGTACCTCTTCCAGCCCCCTCTTCCAGTGCATCTCCACACCCA
TGCCCCTCTCCACTCTCAAATGCCACCGCACAGTCCCCACTTCCAATTCTGTCCCCAACA
GTGTCCCCCTCTCCCTCTCCCATTCCTCCCGTGGAGCCCCTGATGTCTGCCGCCTCACCC
GGGCCTCCAACACTTTCTTCTTCCTCCTCTTCATCTTCCTCCTCCTCTTCGTTTTCTTCT
TCATCTTCCTCCTCTTCTCCTTCTCCACCTCCTCTCTCCGCAATATCATCTGTTGTTTCC
TCTGGTGATAATCTGGAGGCTTCTCTCCCCATGATATCTTTCAAACAGGAGGAATTAGAG
AATGAAGGTCTGAAACCCAGGGAAGAGCCCCAGTCTGCTGCTGAACAGGATGTTGTTGTT
CAGGAAACATTCAACAAAAACTTTGTTTGCAACGTCTGTGAATCACCTTTTCTTTCCATT
AAAGATCTAACCAAACATTTATCTATTCATGCTGAAGAATGGCCCTTCAAATGTGAATTT
TGTGTGCAGCTTTTTAAGGATAAAACGGACTTGTCAGAACATCGCTTTTTGCTTCATGGA
GTTGGGAATATCTTTGTGTGTTCTGTTTGTAAAAAAGAATTTGCTTTTTTGTGCAATTTG
CAGCAGCACCAGCGAGATCTCCACCCAGATAAGGTGTGCACACATCACGAGTTTGAAAGC
GGGACTCTGAGGCCCCAGAACTTTACAGATCCCAGCAAGGCCCATGTAGAGCATATGCAG
AGCTTGCCAGAAGATCCTTTAGAAACTTCTAAAGAAGAAGAGGAGTTAAATGATTCCTCT
GAAGAGCTTTACACGACTATAAAAATAATGGCTTCTGGAATAAAGACAAAAGATCCAGAT
GTTCGATTGGGCCTCAATCAGCATTACCCAAGCTTTAAACCACCTCCATTTCAGTACCAT
CACCGTAACCCCATGGGGATTGGTGTGACAGCCACAAATTTCACTACACACAATATTCCA
CAGACTTTCACTACCGCCATTCGCTGCACAAAGTGTGGAAAAGGTGTCGACAATATGCCG
GAGTTGCACAAACATATCCTGGCTTGTGCTTCTGCAAGTGACAAGAAGAGGTACACGCCT
AAGAAAAACCCAGTACCATTAAAACAAACTGTGCAACCCAAAAATGGCGTGGTGGTTTTA
GATAACTCTGGGAAAAATGCCTTCCGACGAATGGGACAGCCCAAAAGGCTTAACTTTAGT
GTTGAGCTCAGCAAAATGTCGTCGAATAAGCTCAAATTAAATGCATTGAAGAAAAAAAAT
CAGCTAGTACAGAAAGCAATTCTTCAGAAAAACAAATCTGCAAAGCAGAAGGCCGACTTG
AAAAATGCTTGTGAGTCATCCTCTCACATCTGCCCTTACTGTAATCGAGAGTTCACTTAC
ATTGGAAGCCTGAATAAACACGCCGCCTTCAGCTGTCCCAAAAAACCCCTTTCTCCTCCC
AAAAAAAAAGTTTCTCATTCATCTAAGAAAGGTGGACACTCATCACCTGCAAGTAGTGAC
AAAAACAGTAACAGCAACCACCGCAGACGGACAGCGGATGCGGAGATTAAAATGCAAAGC
ATGCAGACTCCGTTGGGCAAGACCAGAGCCCGCAGCTCAGGCCCCACCCAAGTCCCACTT
CCCTCCTCATCCTTCAGGTCCAAGCAGAACGTCAAGTTTGCAGCTTCGGTGAAATCCAAA
AAACCAAGCTCCTCCTCTTTAAGGAACTCCAGCCCGATAAGAATGGCCAAAATAACTCAT
GTTGAGGGGAAAAAACCTAAAGCTGTGGCCAAGAATCATTCTGCTCAGCTTTCCAGCAAA
ACATCACGGAGCCTGCACGTGAGGGTACAGAAAAGCAAAGCTGTTTTACAAAGCAAATCC
ACCTTGGCGAGTAAGAAAAGAACAGACCGGTTCAATATAAAATCTAGAGAGCGGAGTGGG
GGGCCAGTCACCCGGAGCCTTCAGCTGGCAGCTGCTGCTGACTTGAGTGAGAACAAGAGA
GAGGACGGCAGCGCCAAGCAGGAGCTGAAGGACTTCAGGTAA
gctcaggagctggtgggagggaaagaccgggaaggcgacagtatccttgcctacgggtgt
tttttggtttcttgttgcttttttttttttttttccccacttaaaggaaatagctgttgt
ataagttaaaggcatgaagggtcattgctttggctgcttttagagatgaataaatagttc

Exon 21 +      84988      85297   2   Terminal    310    46    Marginal
ttatgtgaaattgctggggttttttaagattaaaaatggctgactataagcggtttccta
tagttcatcatcatagcactttgctaaccacatctgtctgtcactcctcagggaaaggtg
gtgaagggatagccagcttcccttggccagatgttctggcatacgatattcctcccttag
AAAAACACGGAGGAGAGAGGTTGGTGGGAATCTGGAACTGGTCTTCGATATTAGTAGTTT
TAAACAAATGAGGCTTCAACACACAGCAGTGCCCTGTGAGGAGTTGAGTGTTGTGAGAAA
GAGCACGGTCTTGGATGAGAACTGGATTTCCATCCTAACCCATCTGCTGGCCGTTCATCC
CTTCCCTGTGCCTTCAGTAAACGGGCCTCCAACAAGCGCCCTCCATGGCTGCGTCTTCTG
TGTTTTAGCCTTGGGCAAGTTCCTTTACATTCTGGATCATAGTTCCCAGTCTGCAAAAAG
TGGGGAGTAG
actggctggtttctgagtgcgccctctaggaggagatcttttctcctggatcaagatgct
gtcagacacaagcactggactgaaagagtgggatgatggctcggtctccacagtgtccct
ggctctgcctggaacatgacagggactcagatgtttactggaggagtcaccaaggaacca

Exon 22 +      87500      87608   0   Internal    109    90   Excellent
gcctgaggttggtgtcatttaccgatggagaaacagatttggggaaagtgattttgttcc
aagggcacacaactctaaggtggcaagttgggatttgaactccaagctacactgtgcagt
ccatcgtttttataggtagggttttttttttttaagggattttatttcttctaaatatag
AAAACAGGACGCAGTACCTTCTCCATAAAAGCTTTTCCAAGCATTAGTGAACAAGTGGAA
CAGTCATTTGTGGGTAAGGAAATCTTCCTGGTGCAGCGAGCCTTTATTA
gtcaggagttgctcctggacccatttgcttttagtttccctctcactgtggaataaactt
ctacccccatcacagaccaattagttcaggtcaatcaagctggcttttatagagccatgt
ggttcatcaacggcaacgtgactgtttaacagaagccaagctcattatagtaataccctt

Exon 23 +      87721      87757   2   Terminal     37    63    Marginal
cattagtgaacaagtggaacagtcatttgtgggtaaggaaatcttcctggtgcagcgagc
ctttattagtcaggagttgctcctggacccatttgcttttagtttccctctcactgtgga
ataaacttctacccccatcacagaccaattagttcaggtcaatcaagctggcttttatag
AGCCATGTGGTTCATCAACGGCAACGTGACTGTTTAA
cagaagccaagctcattatagtaataccctttgattttggagatgattctaaaggccctg
ggatcctcaagcatctcctcagataccggcggagaaccttgagctgctgggcattaaccc
aaaaagaaagttggtctaggctgcctcccgacttcagcaaatagtgtgtttgttacatgc

Exon 24 +      88242      88297   1   Terminal     56    66    Marginal
tacattaaattacttgcagttgcaaaaattgcatttaattgtgagtcattaaaaggtacc
cagaaatacttttattaaaataaacttgtcgacctgttgcgggtaataggatttgcacat
gcctgcatttctgccttccttatgtcagctggatttcttttcaactcttttttaaaatag
AAATTCAGGTGGACATTCTGGAGACCATAAACATTTTACGGAAGACTGGTGCCTAA
atgtgccttcccatgtccagctaataaaccatggcaggaagtcaacagaacaagccatgt
ttctgaacaccctttcataggtgccacctgagttactcagtgaggggagaaagaactgga
gtgtcatttcagcaaccacagaaagctacaggtgaattttaaagcccaggtttgtgttct

Exon 25 +      89566      89901   0   Terminal    336    47    Marginal
gtcccccaaatgagatgctgatggccagagagcagttttactgcagagagtgtgtgtagg
atcatgggaagaacatgggcattgaatgccttcccatctaggtgttccttacctgggtgc
tgttagttactgagtggcagggcatgctgcccacagagtgaccagcttcctggcctgtag
GGGAGCTCTGTGCCCCCCACCTGCCACATGCCGTGCGCGTTACAGAAGGCAGCATGTGTT
CCCAGTGAGGATCCAATGGCTGATGGCTGTGGTGGCGCTGGTGATGACAGTGGACGCTTA
ATCCGCGTCAGGTGCTCAAGTCCTCACAAAAACAGACCTAGGGAGGCACCGCTAAGGAAA
TTGCCAGGTCTTAGTAGCCGGCCCCGGGTGGAAAGGGGCAGCATGTGGGGAACTTGGATG
ATGGTGATCACTAAAGAACTTGGGGACGAGGCTGTTGCAGAAACGACTCACTTTTCAAAA
GCCCTGAAAGAGAAAAAAGCCCTTTGTGGGAACTGA
gaaacataagtttctattaatttcatgagtgggtggttctatcctttggtgaggctagag
ctttgtcagaatttttaaaacactcctaaaggcttctagaatgatgtattcttttctatc
taggtaagtgcggagcaattgagtcccggctcatggagagcatagagcagggatgtccaa

Exon 26 +      90234      90466   0    Initial    233    68    Marginal
atggagagcatagagcagggatgtccaatcttttggcttccctggcccacgttggaagaa
ctgtcttaggtcacacataaaatatagtaacatgaaagctgatgagctaaaacaaaagaa
agatatcgcaaaaaaaaaagttagtgttttaagaaagtctatgaatttgtgttgggctgc
ATGCAGCTTGTGGGCTGCAGGTCGGACAAGCTTGGTACCTGGGGAGCTCCAGACATTGAT
TCTCCTGGGATCCCTGGAGCCTTTCTCAGTCTGAGACCAGGGCCCCTCATGGGAGCAATG
CAAGTTGAGACAGAGCTTCAGTTCAGCCTGGTCTGCCATGATTACATAGAAATGGAAATT
CCAAGTTCAGAATTTCCTGAAGGCCACTTGCATTCCACAGAAGAGATGGTGAG
gtgcaggccagcactagccggggttgaggttctactgttttcatgacaggcagcggaatg
taggtacgggcattggctctggacctggaaggctgatcagctggcacctcctccaagaag
cctttcctgaccatcgatctgtcacactgcctggtccctcatccctctacttgctgtgct

Exon 27 +      90516      90619   2   Internal    104    65    Marginal
cccctcatgggagcaatgcaagttgagacagagcttcagttcagcctggtctgccatgat
tacatagaaatggaaattccaagttcagaatttcctgaaggccacttgcattccacagaa
gagatggtgaggtgcaggccagcactagccggggttgaggttctactgttttcatgacag
GCAGCGGAATGTAGGTACGGGCATTGGCTCTGGACCTGGAAGGCTGATCAGCTGGCACCT
CCTCCAAGAAGCCTTTCCTGACCATCGATCTGTCACACTGCCTG
gtccctcatccctctacttgctgtgctttactgttcaagacccttaagccttctgtacat
tctgttatggactcattatgtttgtttactctatgtctcccccttcttagatgagagttc
tacccaggcaggaactttgatttcttcactgctgcgttcccagcatctattaatagaatg

Exon 28 +      92345      92462   1   Internal    118    49    Marginal
ggtcaacttctcccccttctattttcacagaagtctttccaagccagggttgaccagcag
gtttccatttgtgtagggggagcagttgcccagggtgctgcatagaactggattctgaag
ctgggttcacactcagggaaagagggctggctaagtgacccatgtctgccttgtatgcag
GAAGGCGAGTGGTTCTGGAGTGCCAGGTATTTGCTGCCTGTGATGTCATTGTGTCTGCTA
CTTTTCTGCTTTTTAAAACTACACTGGACTCAATTTCACCCTTCTTTGAGGGTTCAAG
gtaaccatcaattaatactttgttgtagaaaagatgattctggcatataggagatcctga
ccccacactagaggatccagaagcttgagatgtgacttttgagaagagcgtactcctcaa
gatctccttttccatctgtcactcatggatattgtctgtacttcctggcatccttcagat

Exon 29 +      93724      93806   1   Internal     83    83        Good
cttatggattcaggatgttactctggaattgttttggaatttctctaatggccaatgttt
atgtttacaggtgtgagttttatactcttactgtcttcattcttatgttaggctcctgtg
atttaattttacgagtgagtttagtgaaaacaaatctgtgttaactttaccttcacgtag
GAGCCAACTGTTTGATAGGCCTCAATGAACTGGTGTCAGATATTGTAGTTGAAATATATG
CCGTGCCAGATTATTTCAACATT
gtaattaatgataggtttatatcctttgaaagcatttttaaaaattacagacacagctcg
tgagtgccagctaacagcaggtgttttattaaagtgttgttccgagttgtgtgtggcaca
tggcgaggtaagagcattttgcggtttggtttgcgttgttaattacagctttaaatgcca

Exon 30 +     102108     102264   2   Terminal    157    53    Marginal
cacaggcttgtcttacctttgcaccatctccccaccctctgcctttcccctaccttcagc
aaaagtgcagaatatcagacactgacttcaaatgaattgcactctgagaatttagagagt
tgtgtaagacttctgcggccagcgatgtggcctaaccagctttctgtatggctgtcccag
GAGATCCCTCCTGAAGACTGTGAGAAAAAGGTGCAAGGAGGGACCAGGGCAGGCAGAGAT
CCCAGCCCAGGATGCCCATGGCGGTCTGGCAGGGAGCTTGGAAGAGCACCGTGGCCACGT
GGGGACCCTGGAGCCCTGGAGAGCCCATGTCCTCTGA
aagccggcagctccttccctcccaaactcctttccctccacccttcttgaagcgtcctct
gggttcctgcctccagtgtctcttctccccttctctcttgaactcactttcagggttttg
gctcttcttgaggagccatcaaaccaaggttatcagcagcccccaggatgctcaatgcag

Exon 31 +     104871     104935   2   Internal     65    93   Excellent
gccgggcgtggtggcgggctgaggcaggagaatggcgtgaacacgggaggtggagcttgc
agtgagtggagatcgcaccactgcactccagcctgggcgacagagtgagactctgtctca
aaaaaaaaaaaaaaaaaaacagttgatgctgaacttgttcaaccctttcttgatgtctag
GATTGAGGACTACGTATCTCATTCATTTTGCCGGGATTTTATGGAGGAGCATCTTGGGGA
GCATA
gtaagtccattttccctcccctgcactgaacagatttcttggtgtctgagaacagctgtg
cagtgggaatatcacagagtcttgaattgctcatttcttccttccttacatgttgagggt
ctattattcactcacgcacagttaggtactaagaatacaatgatgaacaaaactcaacca

Exon 32 +     115580     115666   2   Internal     87    56    Marginal
gaaccatttgtgtccagcatcctccttgcggccaaggctgctacgtgaaccttctgtgtt
gatgggcacccgggacttgcttccaccccagagcaggtgttctctgcagccggagggaga
gccaggtgcagctgggctggcttcctaaacagactgggccatttctgttggccactgcag
GCTTGGCCATGACGAAGATGAAATGTATGTAGCATTTGCCAAGCCTTATGAATTTAGGCT
CTGCCCCAGCACCAAGCACTGTCCTAG
gtgatggccttctttttccttctttaaaaacatacagtttcccaagcgaagcgatcaaat
gaagagaggcctaacgtcatttgcctctgcatcttgtgatctctgtttgctcaccaacaa
cgaaggctccaaactcagcagtttcgtgtaacttgctccttaaaatcttctgtagctttt

Exon 33 +     120395     120492   0   Internal     98    88        Good
ctcccttgggaagggcagggaatggggacggtgtatggaggggagggatctcctgcgccc
ttcattgccacacttggtgggaccatgaacatctttagtgtctgagcttctcaaattagc
tgcaataggaaaaaaacaaattgggaaatgaaaaaaaaatgggaagattaaaaagcacag
GGGGAAGAAGAAGAGATTTCGGAGGCCATCCTGCCAGGGGCGGACGGGGCTGACTCCTGC
TCTCTGGAGGACGGTCAGTCCATGTCTCGGAGAAACGG
gtgagctgagcttggcgtttggacccagttcagtgaggttcttgggttttgtgcctttgg
ggcagaccccaggcaaggatgtctgagaccacttgggcgctgttttctcagctccaattt
caagagtgagctatcaaacccagagcggaaggagggagctctgatgagcacggtttgtca

Exon 34 +     121009     121186   1   Internal    178    58    Marginal
aatcggctgcagtatgggatctgataaggatctaggagaagggtctcatgcggaccctca
catgggcagaaaaatggtggtcattggccgacatcacagttttcctgtttcccacccagc
taaaaaccgttgtttgctttaaattttcataaactggaatcctttcacccgctcctacag
CTAACCCTCACAAGCATGAAGTGCTGTGGCTGTTCCTTATCCTAATGATGCGCTTTTGTC
CCGTAAATGTTAACACTCATGAAGCATACCCCGGCCTCTCAGTTCTTGAGGGCCTCCCCA
CCGCAGCAGCAAGGAAAGCTCACGAACCCCAAACCTGGCAAGTCACCTGCAGCCCATG
gtgagctctgggaagtgtggttgaggccttggggtcactccttttttgcatgtgcaaatg
tgctggtcacccttcaacgctcccagacggtcaggaaaactgttccaatcatgaaaaggg
gggatgattttgtaaaagtggcatttcctggtcagtggtggtcttcaagacgacagctct

--------------------------------------------------------------------------------