--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (58374 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        178        348   1   Internal    171    61    Marginal
gactgaaggactgaaggcctgtgaaagggtttcttatctcatccagacattatggtcttt
gcccatttcaggaaatgttggccatgctgagatctacgggctgcaagggaagcttccatg
ctcagggctgtactgcagctcagagaagagcttttatgggggcatttgtccttgcagGGTTTACAGAGAACAGGCAAGAAGTAGGCGGTGGTTCAAACAGAGGTGGAGAGAGAGGTG
GCACCTTCCTTCAGAGAACTACACACAATCAGGAGAAATCCCAGCTCCCATCTCCAAGCT
ATACTACTGATGTCATTTCTTCCCAGACCCTAAAGGCATGCTCAGGTGCTT
gtaggtgagcatatatgaactagcaatgtggctccaggtaactgggagatttctgaatac
agagagaaaagggattgagttatgaccttaggggatggaagacgggaggaggctatttta
tctttgtactcagcattaacttgacagcaaatcctgtttatgaaggaaccacctgatgac

Exon  2 +       5540       5574   0    Initial     35    41    Marginal
ccttggcaccctcgtccccctcacccatggcagttatcgctcagcagtcacaggccccag
gcagggattcagaaccctcatcaacagcatgcgcaggcagctacagactattggggccga
cacaagacccaaaacctatttgccatctctggatcagggattgacacctattgtgtagtg
ATGTGCAAAGTCCTGCTGTGCTCATTCCTGAAGAG
gtgagtgtgtgaggtgcaggtgacacgggttgcacctgcacagagtggttttggaaacac
cctgagtgatactcctgtgagcacctgagcaaaagctgaaatgcacgaattgtaacccta
ctcactggcattgtccatacctagcggccactctgttctcaccttaccactggagtgatt

Exon  3 +       9495       9613   0   Internal    119    76        Good
gtaatggattgcaccagtgattccagccctgtgcagtgtgtttctcagggtgatgcacct
gccaggcagagcaagctgcccgggatggggaggggtgcctgtgacctggcccatgcccct
ggtcatggaggggtgagcagagggcaagcagtccccctgacccatgagcctgtcttatag
GTGTGGCTCCACGTGGATTTCGTTGATGTCTTCATCATTGTCCTAATGTATAACCTTGAC
ATTGCTTCCAAGGAGCTGCTTCTTAAGCGGGATTCCTGTCCTGGGGTGGAAGTCTTCAG
gtctctcctccacatccacgttctgggttcaccttgtgatgtgacacatacattttcatt
tgggttggaaagagccagaacctttggggccttgcagtcttctggcttcacccgagactc
tcattctgtctggcctgtggccaaggccttccagaggtcaagacagggcttgtgccactt

Exon  4 +      14573      14726   1   Internal    154    62    Marginal
ggttagcagcttcagatgtccttgcttggaagataccatttaggaggttaacactaatct
gaacataattttggaatattggtaggcatgtaggtcagacctatgcagaaaggggaagcc
ttcacactcctcacagccatccagtgaattaggtgtaagttatttcacctggctacccag
ATCGAAGGGTGCCAAACCCAGTGGTGTCCGGAAGTGAGCCAGGACTCAACCCCACGGGCA
CCTACCCCCACGGGAGTACCCCAATAGAGCTGAGAATCAAGTTTGTTCACTTTGGTCACT
TAGTTGTGAACAAAGAGATTGAGCAAGGGAAAAA
gtctttgaggcactcgtgactgagtgactgaattctacagttgagacttggaccccaggt
gtttactaactagacaataggcttgtccttcatctcagccacaagggggaaggaaaaagg
gatgcgagagaaatggtgattactttagctgaagataagtaccagctgcagctggcattg

Exon  5 +      20393      20492   0   Internal    100    75        Good
aaacatcttgtgggggggcggggaggtgtgtgtgtgtgtattcaaagggctgcattagtc
aaaaattgtgaggttttatcctatatgtgaaattatatgaataagccccttcagatgtag
tccctagtcaccataaagtgactacatagggaacgtttaatgaaaattgctttttcctag
GTGGAATTTTTCAGGCCCCAAGTGATGAAAGCGTTTTACTTACAAAACCGCCTCAACTTA
CCAGAAAATGAAAGCCAGAAAGCCGTAGCCATGCCCCTGT
gttagaaacaccacgtgtctttgcatctcctccctccccttatgtgtctttttctcttca
gatcagtatttaccgaatgtgccagatttgtaagaatttgcattctaccccccattccca
gggaaagcgtggggtctgcaggggagggaggagccctgtgtgatggcgtggcgggagaca

Exon  6 +      21501      21928   1   Internal    428    89        Good
ggagccggcactgtcaggtggttgcagcagcttctggaaggttggaggggaaggcggtag
cactggaggcagcgggggcactcggccagggacccagggattggaaatgcagccgttctc
gtgtcgagtcagggtgtggcggccgtcctaaggaacactccacctgtctttgggtttcag
GTCCCACCCGAAAGATGCCCCCCAGCGCCAGTGCCGTGGACTTCTTCCAGCTCTTTGTCC
CAGACAACGTCCTCAAGAACATGGTGGTGCAGACAAACATGTATGCCAAGAAGTTCCAGG
AGCGGTTTGGGAGCGACGGAGCCTGGGTGGAGGTGACGCTGACGGAGATGAAGGCGTTCC
TGGGCTACATGATCTCCACCAGCATCTCCCACTGCGAGTCCGTCCTCAGCATCTGGAGCG
GAGGCTTCTACAGCAACCGCAGCCTCGCCCTCGTCATGAGCCAGGCCCGCTTCGAGAAGA
TCCTCAAGTACTTCCACGTCGTGGCCTTCCGCTCCAGCCAGACCACGCACGGGCTCTACA
AGGTCCAGCCCTTCCTCGACTCCCTGCAGAACAGCTTCGACTCTGCCTTCAGGCCTTCCC
AAACCCAG
gtgaggcccacgcaggacgtaagagcttgtccaggtgtcctcgctctctcggcctagcct
tgtctgttggcagggctttggggtgtccttcctgccctgcctgccctctgagttcacttc
aaggtcacctctgctattcttccattccattaatccacataatccaaatgagatcggagg

Exon  7 +      27301      27412   0   Internal    112    92   Excellent
atgatttataaaaagaggaggttcagcctggaagaaggaggtcgtgggctgacacgaggg
ctgtcttgaaaatccaaaaaaaatagcattttttttctttgtttctcactggacagaagt
cacatccctaggtttcagttaaatataggtaaattgtggatcagtgaaagacttttttag
CAGTTGGAACTTTCCATGAGTGGAAGGGGCTTCCATGAAAAGAAGTGGGTGCCCATCACC
AGGCATGTCCAGCCAGAGGACACAGGACCCATGCCAGAGATCCCTCAACCAA
gtgagagttgggacaagggaccttaggccaataataacaataataataaattccattgat
gaaatatctactgtgtatcagggccggtgctattttgcatgttgaatcctttcttactgc
atcctttctggaaacagtagtatagataatgataccaccctcctatagataagaagggtc

Exon  8 +      27730      27864   0   Internal    135   100   Excellent
tagtatagataatgataccaccctcctatagataagaagggtcaggatcagagaggtaaa
gtaacttagttaaggtcacagagctgctcaaatgcagaggctgaatttgagctccaatct
gatgagccctcaagctcatgctgccttccgtgagagcctctgctttttccctcctggcag
GTGCTACATGAACCCCTGATCGATGAGGATCCTGTATTCATTGCCACGTGCACAGAGCGG
GAGCTGCGAAAGAGGAAAAAGCGGAAATTCAGCCTCTGGGTCAGACAATGTTCTTCCACT
GGCTTCATCATCCAG
gtgagccctgggctgagcccggggagggtcggtgaagagggtcggggaagaaaatccggg
cgacttgggctcatctgatacccaagaacttgttcacatacccttttcactgtgggtcca
agtccacccagatgctcctgcggaggccagggctgggctgctccctcctcaccgaggcag

Exon  9 +      28323      28406   0   Terminal     84    79        Good
ggctcaggccgtagcaatgttggctggaagtgtcacccaaacagtgggtcatacgaggtt
tctaccatctccctggaggctgtccctcaagacttttggacttgtggctttgaaacttaa
ggctgtcccagaaggcctccccactcccaccaggtatctgcccaaccttcctgtttccag
GATGCCTTCTTCACAGACCTCCACCAACAGCCTGCTGGTGAAATTATGAATAACCTTCAG
CAGGAGCACGTGCCCGAGTCATAG
gaccttggagccagcatggccaacatgggtgcatgtttcacaagaggtgcctgagctctg
ctttttgtgatgatactcccaggaaaagcatctgaggttgagctgccaggagcagtaggg
tacacaaagggagatggtggggacagatacacaccagaatgtggctcctaagtgacgtct

Exon 10 +      30049      30150   0   Internal    102    73        Good
agctgacaactcccagtcaaaagcagcgtagcttccaccattgccaggggcagccctcaa
aatgtgctcagaggtgcagagccaaggaggcaattaattacccttcagtttcaggctgtg
ccgtgacaggactggcatgagaactttctcagcccccgcagtccctctctttgttcctag
GTCCAACTGAAGGTGCCTGTGGCAGGCACAGCGCAGGGAAAGGACATCTCTGCCTGTGAG
GGGCCAGGAGACGTAGAGGAGCCACATGACCCGGGGACAGTT
gtttttttagagtcctgccccttttcttggttctccaggtgctaatcttggtttgacagc
ttttgaaggtcagcagcctgggcaagcacagccctggggcagaataataccttacaccgt
cagagctttcacactgcagttccctgatcctccccacagccttgtaagacatagagagca

Exon 11 +      35382      35421   0   Internal     40    91   Excellent
gtgaggaggatgctggcatgagatcctgtccaggttggacacggtaagttgaggatggga
ttggctgaggcagaagacataaccgtggacctctttgtgtccttgagcaagtagctgaga
actaccttctttctccacttttgaatgaagttaatccacccacacctctttaccgtatag
GACTTCAAAGATGACAATAAAGTATTTATTAAGTGCCCAG
gtaagtgcaccagctactgtgtggatcagattcaaccctctccctaaagaacttcgactc
ttcaactgcacagacatgagtgtgtacagagagcccacatgctgatacatgtccctcctc
caacctgtcattttgaaagaaccacctcaggctttgagctttgggatgagatgaaggcaa

Exon 12 +      38006      38127   1   Terminal    122    53    Marginal
gtgcctttagctcagtgcctgtccccttctcctgtgacatcccagttgagcgtccacttc
ttcagaagaggctggctggagtctggaaaaatggcagttttcagaggtgcatgtgtggac
acgaggctgagtaatttcaaggcagtcctgcggcaggactgccttccgtattctacccag
GGATTGTAAAATCTCAGCTGCACATCACTGGCTTTTGGGAAAATGTGTTAATTCCAAGAC
AGCAAGAGGCTACCCTGATTCTCAGAGTCATCGTCATCTCCAGGCATGGAGATGATGAAT
AA
ccgttcactcagacccaaagatactgcaaattccaaatagtcttatgcttgggtaatcct
gataaggaagttattttataattatttttagtgggttgttttctgattaagttgtattac
atatttagcatcaaaaacattaaaagcccagcatatctgtcattctgataaatacttttt

Exon 13 +      41568      41714   1   Internal    147    93   Excellent
ccctgtgagctgaaaagatgatgggggcttttccatgggctcccaactggatgactgaga
cccatgagatctgtgcttgctgaatactcgggctcccagcctgacactgctgtgagcacg
ctaacctctgtgtgtttctgttaaagatttatgtccacctgaaggaaggtgggggcccag
ATGGCCTGGATGCGCTGAAGAATAAGCCCCAGCTCCACAGCATGGTGGCCAGGAGCCTGT
GCCGGAACGCGGCAGGCAAGAACTACATCATTTTCACGGGGCCCAGCATCACCAGCCTGA
CGCTGTTTGAAGAGTTTGAGAAGCAAG
gttagtcaagtggggagccagtgaggatacggcccagcctcccctgggaaagtggtggga
gaggtccaggtgggggtgcagatacgtggtggccaccacaaaccacaggatgccaggtga
tgaggcccttccttgagggaacagatgcgtctcagccaccctgtgtgctggatcccgctg

Exon 14 +      45781      45978   1   Internal    198   100   Excellent
ggatacgagacctcaaaacttcagcagtctcttctagaggggtctctagagggtctgact
cccaagcatcagcctcagaaccgggcagtcccgtcctttccttgggggtgcccagggcgg
aggagccgccggcatctccgatggtggtgagtgtgcgatccttcctccctctcccctcag
GGATTTACTGCTGCGGCTTGCTCCGCGCGCGGAAGAGTGACTGCACCGGCCTCCCACTGT
CCATGCTGACCAACCCAGCCACACCCCCGGCCCGGGGCCAGTACCAAATCAAGATGAAGG
GGAACATGTCCTTGATCTGCTGGTACAACAAAGGACACTTCCGCTTCCTGACCAACGCCT
ACTCCCCGGTGCAGCAGG
gtgagtgcgggtccgccattgacacagtggggcgcgcggggattggttgagcttggccga
gcccaccgctgcggtggatgtggcgtccactgtgggctgtgctgctctggggtcagacta
ccctcggttattccccagcatctggggccacgctcctaagtgtggcggctgtgtggaagc

Exon 15 +      50086      50335   2   Terminal    250    67    Marginal
aagggatattcccattgtgaaccaaacccttttgcttttctttcgaaatccaccttgggt
ctgtcatcttcctcctggagtctgcccatttaggattcacattcactaagactaatggga
aggcagaatgtctgcatatgaatatgagtcaggtcttgattcattcacttaaatttgcag
AAAGGTAGCAGGAATGTCAGTCAAGCCACTAACAGCCGAGGAAGGTGCTAAGACAGAACA
ACTGTTAGAATGGGAAGACAGGGCCATGTCGATCTTGAACATCACAGAGACAGACATGGA
GAAGATAGACATGTGTGCAGATCCATATAGCTCTGAATACAGCGTCCACCACGAATCTGT
GCATGACATACACGCCATTCTCAGTGATTCACTCAGTCAAGACAGTCACTATCAGATTCC
CTCTTGCTAA
tattgccaatgttagcaatcagaagatgtcacaggacagctgccttgcctttttcagctg
gggtactacctcagaatccaaaatatcatagggagaggagggtgatctggtttataaact
ggggaaatgctcaaggagaggatgcagatctggtgtggaaacagctcagtttcaagctga

Exon 16 +      53407      53512   1   Internal    106   100   Excellent
atccctctgaagcacctggtggttggtgctgattgttcttcttcaactcttccctcccct
cctcctcctctgctcattattaagttgggagcagctaagctggacgaagataggcacatt
tataaagtggcattaggaggaggtgctgaggaaggggcttatcttgtctctcgccttcag
GAGTCATCATCAAAAGGAAGAGTGGGGAGATCCCATGCCCCTTGGCCGTGGAGGCGTTTG
CCGCTCACCTGAGCTACATCTGCAGATACGATGACAAATACAGCAA
gtaagtggctgggcacctccatgacagaagggctctcatagttgtgccgtctcggaagag
atgtaatggcagatgatcactagtttccccagtgtaagaactgcaggatgaagaccctgg
gaggtaagatcctgccctcagcctgggcttctgggcctcgcctgtgcacacatggcttta

Exon 17 +      55202      55352   2   Internal    151    95   Excellent
aaacccccagctggaactcacctaacatcccaagcctgactcctgcccccatagccctcc
tgcttctgtcgggggcgaacctgcagcgtctcacgggctgtggtgagggggggcctttgg
gatgcatctccgggtgccatgaaccatcgggtcagccgttcttattccctctgtcctcag
GTATTTCATTTCTCATAAACCAAACAAGACCTGGCAGCAGGTGTTCTGGTTCGCCATCAG
CATCGCCATCAACAATGCCTACATCCTGTACAAAATGTCAGACGCCTACCACGTGAAGAG
GTACAGCCGGGCGCAGTTTGGAGAGAGACTC
gtcagagagctgctgggcttggaggatgcctctccgacccactgatgctgggggcgcagg
actcggtcaagggaggggcaagaggaggaggagagcctgccgttccaacttgcccatcag
agacccggacacggcctggtgtgtggcttgctgcctgggagggatgcacagggcctctgg

Exon 18 +      57734      57781   0   Terminal     48    67    Marginal
ctgttcttggtgtctcaaaccactgagcagtttaaaaaagaaatgtttttgagtttggct
aatagaaatacctcttgatgttgcagttgtatgagtgcagttgtatttgaggtgcctgtt
tcattgaagacactagcaggcctgccttccggcctggtggttttccctcttttcttctag
TTTGTGTCGTGTGTCATTCCAGATGAGCAGGAAGAGGTGCTGTTCTGA
caggcagtgggtggctgcattccccagtcatgagagaataattgtaacattgtaacactc
tgtttctaaaatggcagccacctgttgtctgatacatgatgggaaaaggcagctgttgag
ccgggtctaggggaggcttcagtggccacttcaggtctctggaggaatgctgttgactga

Exon 19 +      58222      58273   0    Initial     52    47    Marginal
ccttagagatgtgattcaaagtggctttttggagtgactctagttgaagtgcatctggtt
ccagtatctccctgggttcaacagccctcaggttgattcttgattggctttggagtagct
ggccatccctggggatgaggaaagagcatcgtaagtggtcttatgacagagggagccagc
ATGGCCCTGGCTGAGTATATGGGGCTGGCAAGCACCACTGCACACATGGCAA
gtgagagcccattccactcagatccagccactaagccaagccgatcccctgagggatgtc
tctgctgcaggctctggaaaaaaaagatggagcaatgagctg
--------------------------------------------------------------------------------