--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6905 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1135       1314   2   Internal    180    79        Good
gatggggaaaaggaatcagttggtggaaggacttggggtcaggcaaacaggttggaaggt
ctcagggttgatgctgtctataacccaaataccaaagatagaaaacaacctggctatcct
atgccaatgagatcctgtgttacctgactggtgttgcacaccatctccttggctttccag
CCCTCCTTTCTATGTGTCATACTCGTTTATCTGGGTGACCAACCTGTTCCTATTGGTGCA
GAGAGAGGAGAAGCAGCTTGAGGCATCATTAGATGCACTGCTGAGTCAAGTGGCTGATCT
GAAGAACTCTCTGGGGAGTTTCATTTGCAAGTTGGAGAACGAGTATGGCCGGCTGACCTG

gtaagagttaccagggcaagctaggaagggcttatgggtgggggggcctagcctcctgat
gaataggacatttctaatgatgtaaccatttatcagtttgcaaacatcttttgatttgga
aagagctgggtttcctaacatttagcaagtggattccatggcaaggaagtagagaaatgc

Exon  2 +       1977       2121   2   Internal    145   100   Excellent
atgtccctctttcatagccctgtcatccctgttagtctgttcccacttaggctagtcata
gggctatgagacttttggaggtgaatccaagtgttcctagcctgaaggaactaggactat
tttactaagaaccacccagggaaggggtacaacattcttacaccttgttaccaccaccag
GCCATCTGTCCTGGACAGCTTTGCCTTGCTTTCTGGACAGCTGAACACTCTGAACAAGGT
CTTGAAGCATGAAAAAACACCGCTGTTCCGTAACCAGGTCATCATTCCTCTGGTGTTGTC
TCCAGACCGAGATGAAGATCTCATG
gtaagaggagaaaaagaatacaacttgggaaattaaggggttttttaggcttctttagta
tttagggaaattaagttattagctgagagcctagaaataattttggaggccttgcttttt
gttcttctgaaggcgggagagccactcccaaatagtgctgtaataacctgaggggtatgt

Exon  3 +       2626       2766   0   Internal    141    70        Good
agaagacacaaaaaatgaaggatggagtaaaggagagtgtgtcctagcaaactagatatt
atgtctcaggttgtattttccttgaaaatgcactgtttgcctgtggatgggactttatgt
caggccagatagaatcttcttggagtacagagtaggatcaataaaatctgtgtgttacag
CGGCAGACTGAAGGACGGGTGCCTGTTTTCAGCCATGAGGTAGTCCCTGACCATCTGAGA
ACCAAGCCTGACCCTGAAGTGGAAGAACAGGAGAAGCAACTGACGACAGATGCTGCCCGC
ATTGGTGCAGATGCAGCCCAG
gttggactgagtcactgccttgctgccccatccccatcccatcatgagaagctaggcatt
accattcctgtctagtagggatacatagttggttgcgcctaagttgcttctggcagaacc
caaggaataaatttctccatatcgtttcctagttaccctaatctctgcacaaatttgtgt

Exon  4 +       2954       3035   0   Internal     82    90   Excellent
tgagtcactgccttgctgccccatccccatcccatcatgagaagctaggcattaccattc
ctgtctagtagggatacatagttggttgcgcctaagttgcttctggcagaacccaaggaa
taaatttctccatatcgtttcctagttaccctaatctctgcacaaatttgtgtgttacag
AAGCAGATCCAGAGCTTGAATAAAATGTGTTCAAACCTTCTGGAGAAAATCAGCAAAGAG
GAGCGAGAATCAGAGAGTGGAG
gtatgatgggactggtggctaaacagagaaggagaggtatataagatcactggaatggga
atggttgttttggaagtagtgaagttaggacacaagggtgaactgctttggggtttgtat
ccattctgttagccttttgtatttaaggccagcactgaagcagtggaggaaatgggcaaa

Exon  5 +       3338       3646   1   Internal    309    55    Marginal
attctgttagccttttgtatttaaggccagcactgaagcagtggaggaaatgggcaaagt
aagaagagagaattctgagataggcttgggggtcctctggctctttttctgggctgtgag
ggagtctagatgttgctgaattcagaactccaaaccctggcactcatactggtcttccag
CTGCCACGTTCAGTCCTGCATCAGAAGCATACTTCAGGATCCCCATTACTTTTTCTTCAG
GTCTCCGGCCGAACAAGCAGACCTTTAACCCTACAGACACTAATGCCTTGGTGGCAGCTG
TTGCCTTTGGGAAAGGACTATCTAATTGGAGACCTTCAGGCAGCAGTGGTCCTGGCCAGG
CAGGCCAGCCAGGAGCTGGGACGATCCTTGCAGGAACCTCAGGATTACAGCAGGTGCAGA
TGGCAGGAGCTCCAAGCCAGCAGCAGCCAATGCTCAGTGGGGTACAAATGGCTCAGGCAG
GTCAACCAG
gtaaggtggcaggggttgaaatgaagctgactttgagcaggagtgggagggaataagcta
gattatctgggcctccagcatctctagacctagaggttttctctatttctccttttcact
gtgacccaggaaataattttcagaagtaaaaaaatctcatctgagactctgcaacaggca

Exon  6 +       4518       4662   2   Terminal    145    95   Excellent
caccttcagggagacagctgggtgaagaatcatacttctgacctctgtcaaacagggtca
gatgccgcagaggttctgagatgataaaggaagtgacagagggaacctgaggtaccacat
ttctgatttgtcatgaaagtcttaccttgcttaagatgacttttttaatgttcctttcag
GGAAAATGCCAAGTGGAATAAAAACCAACATCAAGTCGGCTTCCATGCATCCCTACCAGC
GGTGAGTGTGGCTGGCAACCTCGACTCCCTGGTGCTCTTTGCAGAGTTGGGCAGTGAAAT
TACCTTTTGCTCAAGGCTCACCTAG
atgggtacaataaaaagaacatgggctttcagcagcagacaaatcccacttccaccactg
actagctgtgtgaccttggacaagtgacctaatttttctgagcctgtttctcatttgtaa
atggtgataatacctacctcatagggttgttgtgaggattaaaatgaggaaatgaatgta

--------------------------------------------------------------------------------