--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (39912 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      14887      15079   0    Initial    193    60    Marginal
tacctcttctccgttcacacatctattcaccattcacttgctatgtgttaggaggggcac
caaggaattaaaagatgaccaattaaaaggtgatcaatagctgtgttttaagagattaac
ccttcaaattgtattaataaaattagtgattcctaagggcaggatttccacagaggagat
ATGCTGGGATCTCAGGACGCAAGGGGGAATTCTATCAGGACCCCACCTCTGAGTGTCTGC
TATCTCCCTCTCCCACAGTGGCAGATGAAATGCTGCAAGTGTGACTCCAGGCAGCCTCAC
AACTACTACAGTCACCGAGTAGAGAATGTGGCTTCATCCTCCGGCCCCATGCGCTGGTGG
CAGTCACAGAATG
gtgagcatttgccatctacgggaactcaaactgtacagcctccacaggataagacggatg
gaaggtgccctataaccctttgggtttcccaggcatttcttatggtggtgtgacatgggt
gattgataagaagaatctttctgcctcatatttggggtctgttggatgttatggtagaag

Exon  2 +      15632      15705   1   Internal     74   100   Excellent
gatcttgaatagataatataagcagaaacataccactccccactcctctccaagagggag
tttggaaaatcaaggttagagagtttctgagttcctagagctagtctaatccagggcttc
cttcagggctggggaagtggacagtctctggatgacagtttctattttttgtccttccag
ATGTGAACCCTGTCTCTCTGCAGCTGGACCTGGACAGGAGATTCCAGCTTCAAGAAGTCA
TGATGGAGTTCCAG
gtgtgcctcctgggggtggcagtggataggagaggggctcctgggccatgtgggcgtgga
gccatggaggagcacagtgtccttgtctctctgggttggggcaacactcaccatgagcct
atatcatggtgacagaagaggactcgctcctgggctaaaagtggcacctcctggctccct

Exon  3 +      18975      19170   0   Internal    196    99   Excellent
gggagaaacttctgtggcctgtggtatgccaggaggtttggacccggatgctccgagccc
acttgctcccactgggccccctttctcccgagttcactggaggagcctgtctctctgctt
gtgtctccacggggcacagccccagtgcctcccctctgcacactgcccctgtctccacag
GGGCCCATGCCCGCCGGCATGCTGATTGAGCGCTCCTCAGACTTCGGTAAGACCTGGCGA
GTGTACCAGTACCTGGCTGCCGACTGCACCTCCACCTTCCCTCGGGTCCGCCAGGGTCGG
CCTCAGAGCTGGCAGGATGTTCGGTGCCAGTCCCTGCCTCAGAGGCCTAATGCACGCCTA
AATGGGGGGAAGGTAG
gtagagggaatcctgaaaagtaggcctggggagaaatccctgatgtcccactgttcacac
agccacacggactcctgagaagggacggaaacaccctcgccagctccccttgctgacttt
cctgaattcccaccagtaatgacccctgtggccaccctcaaaacatttgctgcttatcct

Exon  4 +      20328      20387   1   Internal     60    63    Marginal
gtcatcagaaaattagtatctcctaaacccttatatgtagatgatatatcttaccatact
ttttgacccagggaactcagaaaattcttaggatacttatattttcaactggcaggggtt
gggggtggggtacacacacacacacgtttagggcccagtgatcatctttctcccccacag
CAGATGACAAGCCTCATAGCCATGGTCTATCTCAGGTTCCAGGTAACAAGGACTTCAAGT

gtgaggcatataatggaaagaaaggtttcttctgaactcggggcacactatttgtctctt
cttcagcgcttctctttcccttccctctgtaggtccaacttaaccttatggatttagtgt
ctgggattccagcaactcaaagtcaaaaaattcaaggtcagtgtggttacttctcttgtc

Exon  5 +      20837      21030   1   Internal    194    69    Marginal
gatttgatacttgccctgcttgccccatagggatattgtctgtgggatgctatgggatgg
ttgaggtctggagaggatggcccacggtatcacatatgaaggagactctatgtgcctcta
acttcctttctttattttccattctccaactcttccctccttgctgtttggccctctcag
AGGTGGGGGAGATCACAAACTTGAGAGTCAATTTCACCAGGCTGGCCCCTGTGCCCCAAA
GGGGCTACCACCCTCCCAGCGCCTACTATGCTGTGTCCCAGCTCCGTCTGCAGGGGAGCT
GCTTCTGTCACGGCCATGCTGATCGCTGCGCACCCAAGCCTGGGGCCTCTGCAGGCCCCT
CCACCGCTGTGCAG
gtaacagcctagggtgggaaggggagaggaagggggcaggaccagggcagactacagaca
ttcttggggctcctgtaaagcaggaagggcactaaatctaagacttgggtatttaatact
tcagcagcaacaacaaaaaatcgaagtggttttcgttccaaaaatcagaatcatttagta

Exon  6 +      22878      22998   0   Internal    121    96   Excellent
tagcagacagtttcacaggagctgggtgaagtctgcggcattcagaggaagcttcctgga
agggttgggatctaagccagatcctgagtggtgcgcagagggtcagagggcagtgggcag
gtccatccctggtgcccttctttgttgattactcctgatggctgacggtccccctcccag
GTCCACGATGTCTGTGTCTGCCAGCACAACACTGCCGGCCCAAATTGTGAGCGCTGTGCA
CCCTTCTACAACAACCGGCCCTGGAGACCGGCGGAGGGCCAGGACGCCCATGAATGCCAA
A
gtaggagctttggatcacccctcccctgtagggtctgggtcgagtgctggcccctctagg
ccttgatgatctcacctgggatgcagggggatccagtctttcttatgtaaatctaaactg
aattgcaccattacaattcaagctctcctggctctgtgaggatggagagagtatttgggt

Exon  7 +      23688      23876   1   Internal    189   100   Excellent
tcttattggtcatgtaaccttaaataagttatacaaacctcccttgccctcagtttcccc
acttccctgccttgatcatcttgcagagttgttacagatgccagtgagcttttgtggagc
atgctctgtagatagcaaaggtgtgggtcagatgtcagccctgggactctctttttccag
GGTGCGACTGCAATGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCA
GCCAGGGGGCATATGGAGGTGTGTGTGACAATTGCCGGGACCACACCGAAGGCAAGAACT
GTGAGCGGTGTCAGCTGCACTATTTCCGGAACCGGCGCCCGGGAGCTTCCATTCAGGAGA
CCTGCATCT
gtgagtagaggctccggagtcccagagtgtcatttgtctgttactccccatctcctctgg
gtacaatagagtacatgttcctgggcacaccaaggccctcagggagcatgaaaacttggc
tgtgagtcaggatttgtgggagattattttaatttagctattactgagcaagtcacttaa

Exon  8 +      25423      25578   1   Internal    156    76        Good
ttatttttattttatagacaaggaaattgaggcacagagggattaagtaacttgactaag
gctgtgaatttgaaatccagtggtggaacaaggatttgaaccaggcagcctggctcctgg
aatctgctctgaactctacttttctttgttcctactgcggtggctgctgttgtctctcag
CCTGCGAGTGTGATCCGGATGGGGCAGTGCCAGGGGCTCCCTGTGACCCAGTGACCGGGC
AGTGTGTGTGCAAGGAGCATGTGCAGGGAGAGCGCTGTGACCTATGCAAGCCGGGCTTCA
CTGGACTCACCTACGCCAACCCGCAGGGCTGCCACC
gtgagtagggggcttggcccagcatgacgtggggtgggctgcatggggccaccagaccca
cggcttgccctgctcactgtgctctcttcagaggaaatcccactgcagggtagacagagg
gggtatgcccgggcctttgccaggagtccggacttcttgccctcttacccagcgccagat

Exon  9 +      26034      26237   1   Internal    204    76        Good
gctgccaggtggctggaactggtgggacagcgcaggggtcctgtgagtcagccatgtcat
ctgcagggaagggccctgcccagttcttttcccaggcagcgcccctccctggatgtgtgt
cctctgggggtgagtttttcatggagcgtctgcctgagctcagcagctctcctcctgcag
GCTGTGACTGCAACATCCTGGGGTCCCGGAGGGACATGCCGTGTGACGAGGAGAGTGGGC
GCTGCCTTTGTCTGCCCAACGTGGTGGGTCCCAAATGTGACCAGTGTGCTCCCTACCACT
GGAAGCTGGCCAGTGGCCAGGGCTGTGAACCGTGTGCCTGCGACCCGCACAACTCCCTCA
GCCCACAGTGCAACCAGGTACGAA
gtgagggtggtccgggggccccctcagtgggaggggggtcctgagcaccagcctctctgc
tgcccctccatgctgcccttctaggcctctcccctgtcagactgggcgtcttctgtcccc
gttctcatttggggaagtcaccagatgtccctccctctgtggctcttggccgtcagtaat

Exon 10 +      26720      26798   0    Initial     79    62    Marginal
tacctgtggaccaggaatctaggacacagtccctgacaccagggtaaggcagaggctgtg
aggcagggtccactgacggtgctctccccacgcagttcacagggcagtgcccctgtcggg
aaggctttggtggcctgatgtgcagcgctgcagccatccgccagtgtccagaccggacct
ATGGAGACGTGGCCACAGGATGCCGAGGTGCATGCTCAAAGCCTGGGGGACGCTGAGGCT
CTGGGGGCCGAGCACGCGG
gtgggcacatggtgggggcgtgtaggtctgcagcagggcaggatgtcctgtactgatgca
tgtggtgtgggcctgggcagccctgtgagtgcacacactccggcctgttggcatggcctc
caagcccctgaggcaggcctatgcccgctgttcctgcgtccccgtgacatgctggttgct

Exon 11 +      27587      27946   1   Internal    360    94   Excellent
gctaagtaagcgtttgctttcactgcagctgttaccatggcttttattctggctgcgact
tctgttattctaagtcatgtagaaagagcctcaggtcagacctcctcttcagggctctcc
ctgacagctgcttctgtctccctgacccctgtctctgactgtcatttttcttggccctag
CCTGTGACTGTGATTTCCGGGGAACAGAGGGCCCGGGCTGCGACAAGGCATCAGGCCGCT
GCCTCTGCCGCCCTGGCTTGACCGGGCCCCGCTGTGACCAGTGCCAGCGAGGCTACTGTA
ATCGCTACCCGGTGTGCGTGGCCTGCCACCCTTGCTTCCAGACCTATGATGCGGACCTCC
GGGAGCAGGCCCTGCGCTTTGGTAGACTCCGCAATGCCACCGCCAGCCTGTGGTCAGGGC
CTGGGCTGGAGGACCGTGGCCTGGCCTCCCGGATCCTAGATGCAAAGAGTAAGATTGAGC
AGATCCGAGCAGTTCTCAGCAGCCCCGCAGTCACAGAGCAGGAGGTGGCTCAGGTGGCCA

gtgccatcctctccctcaggtaattccctttccctgccaagcatttgcaagaattatgct
ccaggggttccagtaccgggcatgctggtccttccttacatttgtacagtgcattacagt
ttaaaggcattttcacagtgctctctctttcaaccattacaacagtcctgtgaggctggt

Exon 12 +      29626      29820   0   Internal    195    91   Excellent
agcctctgtccagcggaacccccttagcctgtggattctctgttctgttgcctttgccca
aggtctctgtttgttctgactcagtagcagttgctctgaggggatagctgctttggggag
gcaaaactccctcctatattttagtgtaagctcctctcccttctcaggcgaactctccag
GGCCTGCAGCTGGATCTGCCCCTGGAGGAGGAGACGTTGTCCCTTCCGAGAGACCTGGAG
AGTCTTGACAGAAGCTTCAATGGTCTCCTTACTATGTATCAGAGGAAGAGGGAGCAGTTT
GAAAAAATAAGCAGTGCTGATCCTTCAGGTGAGGAGAGGGGCACCCGGATAACCCCGGGC
ATGGGCACTGCCGTG
gtgggcatgccaccccctctccctcctgctcctcctccatctccattcctcatgcttctc
gccacaggagccttccggatgctgagcacagcctacgagcagtcagcccaggctgctcag
caggtctccgacagctcgcgccttttggaccagctcagggacagccggagagaggcagag

Exon 13 +      29888      30071   1   Internal    184    89        Good
gtctccttactatgtatcagaggaagagggagcagtttgaaaaaataagcagtgctgatc
cttcaggtgaggagaggggcacccggataaccccgggcatgggcactgccgtggtgggca
tgccaccccctctccctcctgctcctcctccatctccattcctcatgcttctcgccacag
GAGCCTTCCGGATGCTGAGCACAGCCTACGAGCAGTCAGCCCAGGCTGCTCAGCAGGTCT
CCGACAGCTCGCGCCTTTTGGACCAGCTCAGGGACAGCCGGAGAGAGGCAGAGAGGCTGG
TGCGGCAGGCGGGAGGAGGAGGAGGCACCGGCAGCCCCAAGCTTGTGGCCCTGAGGCTGG
AGAT
gtcttcgttgcctgacctgacacccaccttcaacaaggtgacttggggcatggagtccca
cttcctggagcccacaccccagcttgtcacacaccaactgctgccacctgcttcctatta
gggcagatctgcccctgtgagaaccccactcccccagccatcccgacccttgtactgctc

Exon 14 +      30547      30631   2   Internal     85    61    Marginal
ggtgtggggtgggattggttattgaggggctttgggtagcctctttaacaccgccatctg
tccacagctctgtggcaactccaggcagatggcttgcaccccaatatcatgccctggtga
gctatgtccccaagacaatggcacagcctgtggctcccgctgcaggggtgtccttcccag
GGCCGGTGGGGCCTTCTTGATGGCGGGGCAGGTGGCTGAGCAGCTGCGGGGCTTCAATGC
CCAGCTCCAGCGGACCAGGCAGATG
gtaagtgcagccgaggcggggtgggcacaggtaggaggaggcagacaggatagatccccc
gggcaagtcagagttcccattttacactaaagtccagagattttaggtgacctgcttaag
gtgccacagcaagtgcaagatagttttttttctcttttactgaacatccacatgtaagct

Exon 15 +      30963      31077   0   Internal    115    78        Good
ctcttttactgaacatccacatgtaagctgggttggttacaaatgcttcctaggtaggtc
ttggcatagaggatgatccgcagaatcgtggggctgctgagaggttcccttggggcctta
ccccttctgacctagagtgtatgtcaacagattagggcagccgaggaatctgcctcacag
ATTCAATCCAGTGCCCAGCGCTTGGAGACCCAGGTGAGCGCCAGCCGCTCCCAGATGGAG
GAAGATGTCAGACGCACACGGCTCCTAATCCAGCAGGTCCGGGACTTCCTAACAG
gtgagcccagtctccaccccaccttggctgctgttccagtcctgcctgtcccgcattccc
atgttcagtgcatcagccagccctccctccctagtcccaggcctgcaacatccaggcctc
cacttctccttggcaccatggccatgaccttctcgttctcccgtctgccctccccaccca

Exon 16 +      33475      33579   0    Initial    105    53    Marginal
ctccgctcactcaaagctgtacttccttgttcatgtgcctgtctcccattagatttccag
ctccataaaggcagggactgagtttaatttgatttgcagtctcaactcctcccatgcttt
tgctcaaagcagtaaatatttactgagcccatcctgagacccagaaggctctgcgactga
ATGTCATACCGATTGACCCTGAGGATGCAGCTGAAGTGGTGCAGAGTAAAGGAAGGGCAA
GATCTAGGTGGGGATGTGCTCATCCTGGAAGGCTTTCTTGAGAAG
gtgcacatgaagccttgttttgagagtgggactctgggttagaagagaggttgacgagct
ctattaggaaggtccttatgaaagcttgctgctgggataaacccacttaatgaaactcaa
ccacagttatgctgcatgcaagccccgagggacacagcaatgaacaagcatggcttccac

Exon 17 +      34954      35161   1   Internal    208   100   Excellent
cccagaaatccctggagaacaggcgcctgagtctggttgaaagggggcagcagctccttg
ggacaccacggtagaggggccactgtgggtgccttccacaagtgctgctcagctaggaga
ggcctcgtatctctggggaggttagtgggctcctacagtcaaatgcgtgttgtcttccag
ACCCCGACACTGATGCAGCCACTATCCAGGAGGTCAGCGAGGCCGTGCTGGCCCTGTGGC
TGCCCACAGACTCAGCTACTGTTCTGCAGAAGATGAATGAGATCCAGGCCATTGCAGCCA
GGCTCCCCAACGTGGACTTGGTGCTGTCCCAGACCAAGCAGGACATTGCGCGTGCCCGCC
GGTTGCAGGCTGAGGCTGAGGAAGCCAG
gtatggccttgggccctgaacttctctctgcccaggattaagctggcgttttgctcctca
accccgttgctgggagaggggtacagagggctgggagacaggagggggtgcttaccatgg
tggagagtggtacacagagtccagagtgcaggttaaacttaatttgcatgactgtgtctt

Exon 18 +      35565      35706   2   Internal    142   100   Excellent
acattcatcacgtctgcttggtggggtcctgggacatcaaagctactgagttaatacttt
ccttgctctttgccttggctgggaagggtgttcttttggactggtgtgtgagtcgaacca
cacattgattcactgttcactcattctctctctcctctccctgctgcttctctcacccag
GAGCCGAGCCCATGCAGTGGAGGGCCAGGTGGAAGATGTGGTTGGGAACCTGCGGCAGGG
GACAGTGGCACTGCAGGAAGCTCAGGACACCATGCAAGGCACCAGCCGCTCCCTTCGGCT
TATCCAGGACAGGGTTGCTGAG
gtgaggcattatggcttcctccgcccatatttgggcataaacaggaaaatttgggcacca
ggcatagaaaatgccagaaagtgactagataaaacctgaggtggagttctagaggagagt
gacaagctttgggcaggctatgggccttggattttctggtcttgtggctgggatgcagaa

Exon 19 +      36069      36171   0    Initial    103    63    Marginal
aggggtgagaggtgggcaattgtgtttgttctggttggagagggtttttgctgcctgatg
agttggagaaaaaatggggatgaaccccccgacctatgagacccaccacaaaggccagat
ctccctctttccacaaaggttcagcaggtactgcggccagcagaaaagctggtgacaagc
ATGACCAAGCAGCTGGGTGACTTCTGGACACGGATGGAGGAGCTCCGCCACCAAGCCCGG
CAGCAGGGGGCAGAGGCAGTCCAGGCCCAGCAGCTTGCGGAAG
gtgccagcgagcaggcattgagtgcccaagaggtacagagaaggcggagttagctcaatg
atgtacggccagtgagggggtcctgagcagaggaggactttgcacactttataagaccac
aaactcaaaagtgcttagaataacagaaccagaagaggcttgagagtcaacccaaacctg

Exon 20 +      36589      36767   0    Initial    179    56    Marginal
gagatgacctagtccagtccctttccttttacagatgaggtggtgactcgttcacaggcc
taagaatcatctacaaagcaggtcccctgacactggatccagagcttgtctcttggattc
ccagcctggacagatgctctttgcttaacctaacctgggctccatgattgtcagaattag
ATGAGAGAGAAGATCAAAGAGCCCATTCTCAGTGTCTCAAGCACACTACCTGCTCCCGCT
ATGGCCAGGAACATTGGCACTTTCAATCCTGGCACAGTGACCAAGTTGCTAAGTATGCTA
TTAAGTGACAGCCTACTATTAATATCCTATGATGTGACTGACATTGTCCTGGGAGTGAG
gtgggtcatgtcaagagctggagatgggaagagggaaacacagaagtttaagtcatagtc
tgtggctcaggggtttcaataggcaaaaccaatgctattgggggctaataggaggcacct
tcccactgtgtattgatttgggtgatatcaagtgctttggccacaggtctttaggacctt

Exon 21 +      36989      37142   0   Internal    154    96   Excellent
agaagtttaagtcatagtctgtggctcaggggtttcaataggcaaaaccaatgctattgg
gggctaataggaggcaccttcccactgtgtattgatttgggtgatatcaagtgctttggc
cacaggtctttaggaccttgcatgatgacaatgacactgagactattctacctttttcag
GGATTTGAGAGAATAAAACAAAAGTATGCTGAGTTGAAGGACCGGTTGGGTCAGAGTTCC
ATGCTGGGTGAGCAGGGTGCCCGGATCCAGAGTGTGAAGACAGAGGCAGAGGAGCTGTTT
GGGGAGACCATGGAGATGATGGACAGGATGAAAG
gtgagggaatggtttaggggcatggactattgggcattcatgaaggctggtcccacccaa
cccaaggcttctgaagcccgttcttattggagctagccgtgctatgggagtgagatcaaa
tgagattttttctgggcatctagcatgtatgaggctggggaatgcagagatggtcccatg

Exon 22 +      38206      38342   1   Terminal    137    97   Excellent
tgggatggggctggagaggcatgaagctggaggggcaccactgctttagaggccagattt
ttctggaggggattcctctacacatgctacctccagttagcaggaggggaaggaagggtt
gggagtcttggggagtctcaccatcaactcctcctcctgctgctgttccatttgcctcag
ACATGGAGTTGGAGCTGCTGCGGGGCAGCCAGGCCATCATGCTGCGCTCAGCGGACCTGA
CAGGACTGGAGAAGCGTGTGGAGCAGATCCGTGACCACATCAATGGGCGCGTGCTCTACT
ATGCCACCTGCAAGTGA
tgctacagcttccagcccgttgccccactcatctgccgcctttgcttttggttgggggca
gattgggttggaatgctttccatctccaggagactttcatgcagcctaaagtacagcctg
gaccacccctggtgtgtagctagtaagattaccctgagctgcagctgagcctgagccaat

Exon 23 +      39540      39647   0     Single    108    45    Marginal
caggtcggggcagagctggggctcgaactcatgctcatctaatagagccattaagagaat
ggccactaaagccagactgcctcggttccaacagaacctgtcccaaggggttgttgtgag
aagtaatgagttaatgatgtaactcatgtccagtgcctggagcactgtatactcagctat
ATGCACATCTGTATGCACATCAGCTACAACTGCTGGTTCCTTGCTGACCCCAGCCATCCA
TGCACTCTCTACTCCAGACATGCTCAGAAGTCCCTGAACTGCTCCTGA
ctttgaaagaaccaaatgaagcctcatagagaaaaatatgtccattttattaagcacaac
actgagcatgaagctggaggggtggagggcgaggaaactggggaaggacaagaatggtgt
gctggactttcaaggagagaaaagggaacagaggcaggattagaactcctggcagacatt

--------------------------------------------------------------------------------