--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (32381 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1595       1688   0    Initial     94   100   Excellent
cagccgccgctgcctcaccggtcccggggaggcggagggggatcccgcgggggcgcccgg
gcctcgcccgccacgcagccgccaccgctgctgccgccctcggccacgggtcccgacgcg
acagtgggcgggccagcgccgaccccgctgctgcccccctcggccacagcctcggtcaag
ATGGAGCCAGAGAACAAGTACCTGCCCGAACTCATGGCCGAGAAGGACTCGCTCGACCCG
TCCTTCACTCACGCCATGCAGCTGCTGACGGCAG
gtaagggggcctcccgtgtccctctgggtcgcccggccatcccgggcatgagtggccctg
gctttgttcctctcgcttcccgccccctcgggaccgaggcagtcgggagttccggtctca
tcctcatttttgggagcctggattccacattcccacctcagcccggagtgcgtgggagaa

Exon  2 +       8785       8885   0    Initial    101    90   Excellent
cctttctatacccatagccaatattgtatataatatattatgagtttatatttttttctg
ggttgctaatcagtagcttccatcaaattctcagagggacccatgattccaaaaaaaata
aagaacctattggctttgtgctcttgcttgaaacaataagtaatttgataaataaaacaa
ATGAAGTTGTTTTGCAATAGTAAGCTTATGGGACTTCTGATTCCAAAAGATGATACCAAC
AGAAAAGTTGAGAATTATAAATTTGGGGATGATAAAGTCAT
gtgagttgtttaagggaagttgagggtgttaaccatacttttttgtatttgttttttttt
gaaacaggttctcactatgtcactcaggctggagtgcagtaacgcaatcttggctcactg
caacctctgcttcccgggttcaagcgattcttgtgcctcagcctctcaagtaactgggat

Exon  3 +      17580      17733   2   Internal    154   100   Excellent
agagtacacttcttttattagaagcaggctttgggctttctagtcaacttcatatagctt
tagtgctttcagctagtttctttctgaaattggcacatttgtgtgaactatttggtttca
ctatatggtattccatgttattgctttaagcagacttcaaaatttgcatttatttaccag
GGCAAAAATAAATTGTTTTTCCTATTCAGAAATTGAGAAGATTCAGAAAGGAGACTCAAA
AAAGGATGATGAGGAGAATTACTTGGATTTATTTTCTCATAAGAACATGAAACTGAAAGA
GCGAGTGCTGATACCTGTCAAGCAGTATCCCAAG
gtaaggcaaaaagtgctttggatctttgagttatctttatagttatgagagagtcatggg
ctataataaagactcctggggattgtgatgctttagaaacttaagcctgtgaagcttctc
tttcatgcttgtagtacctgttactgagagttgaaatatctaagttcttaactaataaca

Exon  4 +      18835      18951   0   Internal    117    98   Excellent
ctttctagtttcataaccttaagctaatcactttattaatatggcttcagtgtccttcag
taaaatgggaatggtaatactctacctttgcagggttgtttaaaatcaagtgaggtaatt
tatgtggaaatgtttttatatagtagcatgtatatttagaaatcctctattttctgtcag
TTCAATTTTGTGGGGAAGATTCTTGGACCACAAGGGAATACAATCAAAAGACTGCAGGAA
GAGACTGGTGCAAAGATCTCTGTATTGGGAAAGGGCTCAATGAGAGACAAAGCCAAG
gtaagctcacattagtgaggcaagaggacatcctaatgccttctacttgcccagaatgca
gtatggatgtcttatagaggcggcaagaattttgtatgtgtacagaatgtggctccttta
agtttgcactggatgcaagagattatacaccaagttaatttacttggcttggcaaccctg

Exon  5 +      20499      20645   0   Internal    147   100   Excellent
ctttactgtttttcttttttcttttttctttttttgtttaattcttctcagctcatacca
attaactttactgtttttcatggacattaggggtatttcttgctgttcctttggcttaga
ggtaaaggtggtgttttctccctagtccatggtgtgacatttctctgcatttttccatag
GAGGAAGAGCTGCGCAAAGGTGGAGACCCCAAATATGCCCACTTGAATATGGATCTGCAT
GTCTTCATTGAAGTCTTTGGACCCCCATGTGAGGCTTATGCTCTTATGGCCCATGCCATG
GAGGAAGTCAAGAAATTTCTAGTACCG
gtaaggaaatccatatcctgtgtcttctgagcaaaagagaactgggatcttatactgttg
tgaaggtaggggttcttaactaaggtctctgcataacctgtatgtataccaaattctgca
cttatgttcattttccttaggtagttcgttacttgcacctagttctcaaagcattatgct

Exon  6 +      24221      24310   0   Internal     90   100   Excellent
caagacttttctcaaagaggtgacagatagggtgccatttgacttcagagaaggaatgac
ctgagacctcatctgggctctcaagagctcttcttagaattcaagtctcccgtggaccag
atgatttctcagtagaaagtgtagataccacacaatactccttgtatctttcgttcccag
GATATGATGGATGATATCTGTCAGGAGCAATTTCTAGAGCTGTCCTACTTGAATGGAGTA
CCTGAACCCTCTCGTGGACGTGGGGTGCCA
gtgagaggccggggagctgcacctcctccaccacctgttcccaggtaaaaataatggaga
cacccagaaataggatgtgaatttgactactagtgtcatctcttttagtggtgctcttat
gtctagcttaggaagggtctcaggatttgtatgttgcataaagaacagaattctacaacc

Exon  7 +      25146      25340   0   Terminal    195    61    Marginal
tataggacctgggggatcttgcagtgtgggtcctttaccctgtacattcctctgtgcttt
aataatagcctagttaaggcttcataaaatctgcctaattccagaatttgtaaacaaatc
agaacataaaagtggcctgtttataaaaagctccatttaagataaactttcattttgtag
GGGCCGTGGTGTTGGACCACCTCGGGGGGCTTTGGTACGTGGTACACCAGTAAGGGGAGC
CATCACCAGAGGTGCCACTGTGACTCGAGGCGTGCCACCCCCACCTACTGTGAGGGGTGC
TCCAGCACCAAGAGCACGGACAGCGGGCATCCAGAGGATACCTTTGCCTCCACCTCCTGC
ACCAGAAACATATGA
agaatatgtaagaaatttgaacaatgtgccatttcccagtacctagaaggctgctaaagg
aagttgaatgacagggcctcggtcctttatgtaggtgtcatggactgcctgtaagatttg
caatctgccctcttctcttgcagtgaatgttgaactattagaagatttttccattttagg

Exon  8 +      25863      25930   0   Internal     68   100   Excellent
gttttctttgtttagtaaccctttctcttttgactattctacagtaggcattaacatttt
ggagggaaatgtcatgtccttttaattcagaagcctacttactcccatgggatgtaatta
cctttcctactctctatgattttgatcttttatttcatttttttgttgttgttgttctag
GGATATGATGATACATACGCAGAACAAAGTTACGAAGGCTACGAAGGCTATTACAGCCAG
AGTCAAGG
gtgagtcaggcagtataagcactgttttttgtcctgaggatggatggagggagttggagg
aacagagagatttagacagtacaaccctaaggagcagaatggttcgccttttgagggtat
ctcctctgcaacccccacagtcctgactggtcttgaactcttgagctcaagcagtcctcc

Exon  9 +      26826      26884   2   Internal     59    96   Excellent
attttataagtacatagtctatacatattttggaaatactttacggtttagggatggggc
agaatgagtattttcctgtattaatacacttagtaaaatgactgacttatggaagtattt
gagagaaagttgaaacatagttactctgtagcttcctaacactctgcctttggctttcag
GGACTCAGAATATTATGACTATGGACATGGGGAGGTTCAAGATTCTTATGAAGCTTATG
gtatgtctttatctctgtggtggggcagaatgtacaagtaagtgcctgggagaatgctgg
tgactaaagtattgagagtcagacaaacacacctacggataaacctttagaaggccaaga
ttttgctagatgtgacagtaagagttctgctcttgcttaaattttgcggtacatggtaga

Exon 10 +      29838      29935   1   Terminal     98    55    Marginal
aaaattgcccaggctgcccaagagggccaagccaagtagagagcaaggaacaccagggga
agtgtcaagacattagaagaaactcagtgtttttggtgatctttactatgtgacctatcc
ctgcttatccctaagtgctgtcgccacatggtttataaactgtctttgttttccccacag
GCCAGGACGACTGGAATGGGACCAGGCCGTCGCTGAAGGCCCCTCCTGCTAGGCCAGTGA
AGGGAGCATACAGAGAGCACCCATATGGACGTTATTAA
aaacaaacatgaggggaaaatatcagttatgagcaaagttgttactgatttcttgtatct
cccaggattcctgttgctttacccacaacagacaagtaattgtctaagtgtttttcttcg
tggtccccttcttctccccaccttattccattcttaactctgcattctggcttctgtatg

--------------------------------------------------------------------------------