--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (56588 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1345       1413   0    Initial     69    80        Good
gaagctagcgagccccgcccggccgccgggaaggtgggggaagccccgtgcaccccccgc
cctccggccgccgccgccccgctggccctgcagccgtcgccgctgcctcgggctacagcc
ccgggctcggcggtcccggctggggaaggagggcggcgagcgcgtccggagccgccggag
ATGGCGGGAGGGCACTGCGGCAGCTTCCCCGCGGCGGCGGCCGGCAGCGGCGAGATCGTC
CAACTGAAC
gtaggggggaccaggtgagtcggcgggtagcgggcttgcagcggggatgccttggcggcc
tcctcctttggtgtcgacggggaccgagagtcgcaggaacgagggcgagcgtgggaggcc
aagcctggaggggaacgtgggggcctccaggcggcaagaacgtcgggcggattttggagc

Exon  2 +       9560       9633   0   Internal     74    94   Excellent
caccatctcatgaaatgcacacagactacattccaattttagaaacattaaagtttaaga
gtggaaacaaggaaatgtagtatttaagtaattaagacttcattccctattagtgttaca
gatattaaagttaaaagattaatttgtaatttgaaaataaaactgttctcttttttacag
ATATTTATTGATAGAGATCCAGCAGCATTTGCACCCATTTTAAATTTTCTTCGGACAAAA
GAACTAGACTTAAG
gtaagaaatgcactctttttaaagtaaattcttactgataaatatgtgtttttaatatgt
tttatgaaataaaaggttttttttgtttgtttttttttttccttgagttgcagtcttgct
ctgttgcccaggctggagtgcaggagtgcagtggcatgatctctgctcactgcaacctcc

Exon  3 +      12659      12796   1   Internal    138    80        Good
ttttttcattttcattttattttttaattgtaattaaattatttgtaataatttgctata
ttggaagatgtatttcggctttaatgaaattcacatttttgtttctttgtcacaatgtga
tatttttaatttttgaaaggtgaacttaggaatgtatttgttttcttcttctctttatag
GTATTCCTAGTCGTAAAATAAACAACACAGTCAGATCTGCTGATTCTAGGAATGGTCTAA
ATTCTACAGAAGGTGAAGCCCGGGGAAATGGTACACAGCCTGTTCTCTCTGGAACGGGAG
AAGAAACTGTTAGGCTAG
gtaagcaaagattacagaaatagaaaaagaaaaatacgtatgtttttagtgctgggtgat
attgagtaattacttttaaagatttttgcctcatctccttttttatccagatttatcatt
tatatcttggaaaggtctcatttaacacttaatttttatttaaaatgttgtgtaatcttc

Exon  4 +      17811      17887   1   Terminal     77    89        Good
agtaaaattatcccaagtaaactaaataagaaggcttttcatgaactgggaaattgttgt
aaccaagctgatatggagttggaaccaagctgatgtgctagccaattccaatacatgccc
acaattagaatactgatccagatttctgtgttacccatgcctcttgtttcttctgaacag
CAGCCACAGATCACTGCTTGGTCCACAAGGATAAGCAGGATGAGTCCAAATTGCAGAAAG
AACTCAAAAACTACTGA
tgagacaaatctaataaaaagcataccatagtttttgaaacaattttcctattttcagtc
tttcatttttactaaagaaatcatggtaggactgatttgtttgcaaaataagctttagtc
ttattatacttggcctgattatttgtataaagtgcagcaagaataattagttcctatata

Exon  5 +      18712      18789   1   Internal     78    72        Good
agatagagagaaagaaatatgctccaaattttgtttataagagtatactttactcagttg
ttaaaagctgcaaaatctcgaaagaaaagtgttcttgactccaaagtcagctaattggtg
ctgcagtctatttcctttgggttgggggtctctccactatctcatttcatggtttcccag
GAAGATGTTACTGGAAAGGGGTCCTCATCCAGACCCCCAAAAAAGAGTTCTTGGATCTCT
CACAAGAAAGAATTCAGG
gtgagtccttagagtaaagtgaaagcaagttcattaagaaagtaaaagaataagagaatg
tcagcaaattttagtgtttattaggtaagtatttaagtattttcatttgtttatcttaac
aaatgaatcccatctggtggctgaagagggtggttacaaattacacaatgcttaggaaaa

Exon  6 +      20154      20344   2   Internal    191    66    Marginal
ttgtggcttcataggcaatatagatcaacaaaattttatttgtaataggaaggtggatgg
gtaactgtttagttttttttttgttttttgttgttgttttttgtttttggtgcattgatg
tgtattccgtttgcttcattgctgctgagtctaccttatgtgcctgttcttccttaacag
AATCAAAGAATCTTCAGGATGGCAGCAAGTGTTTACGAGCCCATATTTGGATTGGACTAT
CGAACGAGTAGCTTTAAATGCAAAGGTGGTTGGAGGGCCACATGGAGACAAAGACAAAAT
GGTTGCTGTTGCCTCAGAGAGTAGCATCATCTTGTGGAGTGTTCAGGATGGGGGAAGTGG
AAGTGAAATTG
gtaggaagaatcttgtttatgttgcaatttgatgatattaatattttgaagtttataaaa
gagattgacactgaatatgaaaattaacctggactgtcagttagctagagctgtcacagt
atttaatgtgggaggaatgatctgataatgaaggaaaaatgatgttttagaaaagacatg

Exon  7 +      27313      27346   0   Internal     34    50    Marginal
ttgtcactggtcttgagtatagtacagttctgaacaaaaagagaatacctagcaccagta
taagattcaaaagaaatcagtaatctttctggcttatgcttttaaagcatgttatatttg
catttagttgctttgtttttcccatgagttcttcaaggtttcatgcattttttttctcag
CTAAATGCTGACGAAGTTGTCTGTATTGGCACAG
gtactttttaaaaataaactgatacttgaagcagccaaagatctacataaaacagtattg
tagaggtgagacttatttcccagcattattagataaaaatatatttcccataaagtgttt
ttcaaatgattaagataatgctatttaagtgctagaattggaatacaacttttttttttt

Exon  8 +      29041      29129   1   Internal     89    54    Marginal
gagtttcttatttctagtccccaacacgtatagcacatagtttgtagtaatgagaatata
aattagtcacctttaagatgtttttaatccaggttttgattaattctaaaaatggtgact
gattaacctttttattttttattgtcatttaaggagtgttcagcctgggtgttcctgtag
ATGCTCTCTTCTTTATTGGTAACCAGTTGGTGGCCACGAGTCATACAGGGAAAGTGGGAG
TGTGGAATGCTGTCACTCAGCACTGGCAG
gttagtttaaagcatattacagaagtgaaaatatttctgaaatgtatgctgattatgtat
tttttttttccttgtagaattcgtactgtttctggttttggttatacaaatattgaataa
atgtagtggtaaatttttttgctagatgcatatttgagcatattttcaagagtttaagtt

Exon  9 +      30450      30590   0   Terminal    141    83        Good
ttggtggaagaaagctaggttgcaggaaatgaggaagtaaaagatcagagaagagagaca
gcaaattcaaatacctttcaagaagtttggtggtgaaggaaagcagagaatccaagtgat
agcttaaggatcaaggctggtttgaaaaaaaagataattggtgctttatttttcctctag
GTTAGGACAGGCTTGAGCACACTTGTAGCTAGAGAGGAGAGTTGCCAGAAGGACCTGAAG
ACTGAAAGAATGGAGATTATTTCCGGTCCCATAAAAGTCAAGAGTGTATATGGGATCTAC
AGCACAGCTAGAAAGGTTTGA
cccaacagggagtagagacatttctttctctgtgacagaagggtaaggaaggagtaaaga
gaaagacgttgaagaatattatcaaatactgcagagattaatcgtacatttgcagtagac
ctgggatcccatgtagttctttagttacataatcaaggtagattttaagtatttgagtca

Exon 10 +      34987      35023   2   Terminal     37    77        Good
ctgatttcgaattcctgacctctggtgatctgcctgcctcggcaggtttcttttagcaca
aatatgggaaggtattaatttgtaaactagattgattttcctggaaaaactaattttttt
attcctatactttaaaaaaataaatacaaatgagactttgtttcccttgccatttcctag
AAAAGAAGTAACCTTTAGCAAGGAGAATGAAAAATAG
agaataccaccttttcagagaaataataaattatcaagggagcaagtactttctggaaat
cagttgctttgtttactagttctgattctgtcacttgcttactgtgtaactttggacagg
tcatttaatctcttgtatgagaaagggaaaagagagggacctggtcagactcggccttcc

Exon 11 +      35745      35859   0    Initial    115   100   Excellent
gatcattccttctgcttggatgtaacaatggatcaatatattacataggtaagtgttcag
tcacttaaaatgctcctgcttaatgtaattttttaaatgagaacaagaaaacattacctt
tcagttttaaatagatatgctatttattttaatgctgtttaaaatttttatgttttagat
ATGCAGAAGTTCCCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGAACTGTATCAT
GATCCTTCAAATGATGCTATTACTGCTCTGAGTGTTTACCTCACACCCAAAACAA
gttagtacatggccaattatatacattcttgactttttatctttttattcattagtttat
tatgtgactaggtcaaattaaactggtttatttctttttgagaactgcagtgcctaagga
tttcatctctactaagtctaaaatttgtattcagttttatactgaagtcaaacatgacca

Exon 12 +      37790      37960   1   Internal    171    97   Excellent
aataatgattttaagatgaccggagaagtcttaagatttttttttttactgaactggatt
tggggctgatataaacagtgaatccagctctgcctattttatcatagggaagctttgcga
gggtagcttttttattatcgttccataatgtatcacctgtcaactcttgactttatatag
GTGTCAGTGGTAACTGGATCGAGATCGCCTATGGTACGAGCTCTGGAGCAGTACGAGTGA
TTGTACAACACCCAGAGACAGTTGGGTCAGGTCCTCAGCTTTTTCAGACTTTCACAGTTC
ACCGAAGTCCCGTAACAAAAATCATGCTATCAGAGAAGCATCTTGTATCAG
gtaaaatgatttcattatactggtaaggaacttggctctgtgtgttattttcattaaaag
aatgaaaacgcagtgtttatgtgagaaaaatatactaaaagaagtactagaaaagtttaa
tgactgaagaaattatgattgtcttttaaagatttctttgagctggtcgtggtggctcat

Exon 13 +      41675      41830   1   Internal    156    95   Excellent
aaggtaaaacatccagttttctcacttttgttaagtagtcacaaatcaagtatagtttta
agataaatatgtcatttgccacttatactctgatctgtgtaatatagatgatagtgaaaa
aagttaaaatgagtttttaaaagtaattttgtattcttttgtgttctctttctctgctag
TCTGTGCAGATAATAATCATGTCCGGACGTGGACAGTAACACGATTCAGAGGAATGATCT
CTACTCAGCCAGGTTCTACTCCTTTAGCGTCATTCAAGATACTATCCCTGGAGGAGACAG
AAAGTCATGGTAGCTATTCCTCTGGAAATGACATAG
gtgggttaggttattttagggcatttttaggtactatattaactgttcagaagaagcata
tcaactaataaaaccacaaaaatgagttttaaatacaaattttccattttaattttgaaa
ttctaaacagaattttagtgtgtttttctgattaaattctataaattcacaaaattattt

Exon 14 +      46596      46641   0    Initial     46    47    Marginal
aatttcaaaaatgaaatatctctcatagtacctaaccataatagatgtacagtagaagtt
aatttcctcttccttttctattgactgaaattttacttcttttaaaattattatttataa
cctcagattttgcttcaacattcctctgcattaaacaaatttttttgacgatgagaacac
ATGGACACATGGAAGGGAACAACACACAACAAGGAGCCTGTTGGGG
gtgagcggggccggggagagagagagcatcaggaagaatagctaatggatgctgggttta
atacctaggtgatgggttgatctatgcagcaaaccactatggcacatgtgtaacagacct
gcacatcccgcacatgtaccccagaacttaaaagttacagggaaaaagttttttgcatgt

Exon 15 +      52544      52728   2   Internal    185    94   Excellent
agctgtatattttttctggtttcagattttaaagatttacacataaattttaaatgattt
tttaaaagtcttttctagtataacatgtttgctttctttctttctgtctttttagtttca
tagcttctttttaaataattgctcattcccatcagggctctttctgcttttcttttgcag
AATATGTGAGATCCAGGCTGTTGACTGTACTACAATATCCTCATTTACAGTGAGGGAATG
TGAGGGATCCAGTAGGATGGGCTCAAGACCAAGGCGCTACTTGTTCACAGGCCATACAAA
TGGCAGTATTCAAATGTGGGATCTGACCACTGCTATGGATATGGTTAACAAAAGTGAAGA
TAAGG
gtaggttctcatacagaaagatgtttgtcacaaggttaagcttttcacttaagtgatttt
aatgactatttgttctcctaagatgtaggtggtccaaccgaagaagagctactcaaatta
ctcgatcaatgtgatttgagcacatctcgctgtgctactcctaacatcagtccagcaact

Exon 16 +      52817      52949   1   Internal    133   100   Excellent
gcgctacttgttcacaggccatacaaatggcagtattcaaatgtgggatctgaccactgc
tatggatatggttaacaaaagtgaagataagggtaggttctcatacagaaagatgtttgt
cacaaggttaagcttttcacttaagtgattttaatgactatttgttctcctaagatgtag
GTGGTCCAACCGAAGAAGAGCTACTCAAATTACTCGATCAATGTGATTTGAGCACATCTC
GCTGTGCTACTCCTAACATCAGTCCAGCAACTTCCGTAGTTCAGCATAGCCACTTACGAG
AATCAAATTCTAG
gtaggttaaagagttgggtattataaacaaaatttatttcttttggggaaattgactgaa
atattgtaatcacatagttgttctagaaagccatacttctcaaggtacattttaaattca
gacattatgttaactttttaacagttttaccaaatttcttgataggcatatctggttctt

--------------------------------------------------------------------------------