--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (20401 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (19 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       5762       6323   0    Initial    562    87        Good
tggtagagaccctgcaggctgcaggtgagccctccggggcccaggaaggaggccacccca
cacccagagcagagcccggctcctcactcattgtcctactgccagtgtggctcccctcca
aagctgccagggctggatggggaatttggcctgggctgtactcaatgctgcgtgccgtgt
ATGCCCACAGTGTGCCCCAGCCTGGATATTCGCTCAGAGGTGGCAGAGCTTCGTCAGCTG
GAGAACTGCAGCGTGGTGGAGGGCCACCTGCAGATCCTGCTCATGTTCACAGCCACCGGG
GAGGACTTCCGCGGCCTCAGCTTCCCTCGCCTCACCCAGGTCACCGACTACCTGCTGCTC
TTCCGTGTCTACGGACTGGAGAGCCTGCGCGACCTCTTCCCCAACCTAGCAGTCATCCGC
GGGACGCGCCTCTTCCTGGGCTATGCACTGGTCATCTTTGAGATGCCACATCTGCGTGAC
GTGGCACTGCCTGCACTTGGGGCCGTGCTGCGTGGGGCTGTGCGTGTGGAGAAGAACCAG
GAGCTCTGCCACCTCTCCACCATTGACTGGGGACTGCTGCAGCCAGCACCTGGCGCCAAC
CACATCGTGGGCAACAAGCTGGGCGAGGAGTGTGCTGACGTGTGCCCTGGTGTGCTGGGT
GCTGCTGGTGAGCCCTGTGCCAAGACCACCTTCAGCGGGCACACTGACTACAGATGCTGG
ACCTCCAGCCACTGCCAGAGAG
gtgggcactggcacagaacatgaatgtagggaagggagagagcagggtcacatggggctg
ggtggccacaggatggtgtgggtcagtactttcagctgccactgttttttaatcctcact
catcctatgaggcaggtaaggaaactaaggctcagaaaagttacgtaaccaatgtggcat

Exon  2 +       8040       8187   1   Internal    148    76        Good
tctaacacaccactctccccacagtgtgcccctgcccccatgggatggcttgcacagcga
ggggcgagtgctgccacaccgaatgcctggggggctgcagccagccagaagaccctcgtg
cctgtgtagcttgccgccacctctacttccagggtgcctgcctgtgggcctgcccgccag
GCACCTACCAGTATGAGTCCTGGCGCTGTGTCACAGCTGAGCGCTGTGCCAGCCTGCACT
CTGTGCCCGGCCGTGCCTCCACCTTCGGCATACACCAGGGCAGTTGCCTGGCCCAGTGCC
CTTCTGGCTTCACCCGTAATAGCAGCAG
gtgagtgtagggagggtggggggcaccctgggagcagtgaggaggcctgaggaggcccaa
actggtccaaggctcaggacatctgcttgctcctgctagcatattctgccacaagtgcga
ggggctgtgccctaaagagtgcaaggtaggcaccaagaccatcgactccatccaggcggc

Exon  3 +       8621       8785   2   Internal    165   100   Excellent
ctttggggccacacccctcctcctggtcatacccttcctcccagacacaacccttacaat
gacccaactcagcacaattttccatcatcctgggtcccagtcctgagggcccaccttccc
ggggcccccattcagcccccttgccccacagacccatcaccttccttgctcctactccag
CCCTGTCTTCCCATCCCTAGACAACCTGGAGCCACAGCTGCAGCACAGCCTGGGGCTGGT
AGAAACCATTACTGGCTTCCTCAAAATCAAGCACTCCTTTGCCCTCGTGTCCCTGGGCTT
TTTCAAGAACCTCAAACTAATCCGGGGAGACGCCATGGTGGATGG
gtaagggttaggcctctgaccagctccttctattacactccttcctccaacactcccaga
acagtggtgaagagaatgggctctggaaccaattttgctactcactaggcgtgtgactct
aagtaggttaacttctctggtcttcagttttctcatctgtaaaatagggctaatataaca

Exon  4 +      10615      10829   2   Internal    215   100   Excellent
ctggtcagtggcacagagtgggtatgcacgaatgcccccggtgtgctggtgtgagccagc
cactgagtgcccctctccccgggcccagcaaaacccttccaggaggaacccataagccat
cccctttcccaccccctgcccccacctccccgcagagcaaggtcccctggcctcccccag
GAACTACACTCTCTACGTGCTGGACAACCAGAACCTACAACAGCTAGGGTCCTGGGTGGC
CGCGGGGCTCACCATTCCCGTGGGCAAGATCTACTTCGCCTTCAACCCGCGCCTCTGCTT
GGAACACATCTACCGACTGGAGGAGGTGACAGGCACGCGAGGTCGGCAGAACAAGGCTGA
GATCAACCCCCGCACCAACGGAGACCGCGCCGCCT
gtgagaccccaaccccagtgccggtggacacgcggccacacactagacacgcacacccgg
gggagggagaaagctcgagggggacactctgagaagttctcctcagaggtctcactggga
atgggatgccgcggggtcagggtgggcgctcaagcagctggcaggcgcggttgcgagcag

Exon  5 +      11028      11154   1   Internal    127   100   Excellent
tgccggtggacacgcggccacacactagacacgcacacccgggggagggagaaagctcga
gggggacactctgagaagttctcctcagaggtctcactgggaatgggatgccgcggggtc
agggtgggcgctcaagcagctggcaggcgcggttgcgagcaggcccctcgccccacccag
GCCAGACTCGCACCCTGCGCTTCGTGTCCAACGTGACGGAGGCAGACCGCATCCTGCTAC
GCTGGGAGCGCTATGAGCCACTGGAGGCCCGCGACCTGCTCAGCTTCATCGTGTACTACA
AGGAGTC
gtgagtgccgggggcggggccggagcgggggcgggaccggacgaggccaatttcttcggg
accacaggcaggtgagggcggagctcagcgaggctatgaagacccaggaagccaggaccc
gcaagttgtactccgtggtagggcccaggtctggctctcttccctcaccttcttcatgcc

Exon  6 +      11250      11291   0    Initial     42    45    Marginal
cagaccgcatcctgctacgctgggagcgctatgagccactggaggcccgcgacctgctca
gcttcatcgtgtactacaaggagtcgtgagtgccgggggcggggccggagcgggggcggg
accggacgaggccaatttcttcgggaccacaggcaggtgagggcggagctcagcgaggct
ATGAAGACCCAGGAAGCCAGGACCCGCAAGTTGTACTCCGTG
gtagggcccaggtctggctctcttccctcaccttcttcatgccttcatgcctcggtttcc
cctcaccaagtgaaatggagaagacagggcttctgagagcccaggagagccatcctgctg
ggaaggcttggatcattaaacttcacttcattatgctaatgttctacactgaccacacgc

Exon  7 +      13318      13556   2   Internal    239    83        Good
tatcacagtccctcccctcctccgcccccccttgccaaggtctaacaggtggctggagtc
atggctttgccctcatgcatactggaaggacaatgacagtcctggggtgattcagagcgg
gggtgccagaacttgagggtggggttgaatgacccctcagctctggggatgggtgttcag
CCCATTCCAGAACGCCACAGAGCACGTGGGTCCAGATGCTTGTGGAACCCAGAGCTGGAA
CCTGCTGGATGTGGAGCTGCCCCTAAGCCGCACCCAGGAGCCAGGGGTGACCCTAGCCTC
CCTCAAGCCTTGGACACAGTACGCAGTGTTTGTGCGGGCCATCACGCTAACCACTGAGGA
GGACAGCCCTCATCAAGGAGCCCAGAGTCCCATCGTCTACCTCCGAACGCTGCCTGCAG
gtaggcatttggagggtgcaagagtcagtcagacgcctgcatccatgagaacaggggagc
acaggcaccagaaatagagaagccggggcactgaacacctggcccacagaggctggaagg
ccagatgcttgagtcctagaaagaagggggagcatttgcctaggtccttgcggggctggg

Exon  8 +      13956      14123   1   Internal    168   100   Excellent
ggcctatggcagagaaggggaggacagaaacaaaacactgagttctaggaagccaggggt
gaggatcacctattctttgggagaacaaggctgttggaccccagaaaggagggctcatta
ctagatagtattcaggaggaagacccacacccctgagttgcatccttctcgcactcctag
CTCCCACGGTGCCCCAAGACGTCATCTCCACGTCCAACTCCTCCTCCCACCTCCTGGTGC
GCTGGAAGCCACCGACCCAGCGCAATGGGAACCTCACCTACTACCTGGTGCTGTGGCAGC
GGCTGGCAGAGGACGGCGACCTCTACCTCAATGACTACTGCCACCGCG
gtgcgcagggacgacgcgcaggccggccgcggggcgggtggggaaggggagatggaggcg
cagggccccggcaggtgggggggatcagaggcgggtagaccgcctgtcttactagtgtct
tcccgctgcggcgccaggcttgcggctgcccaccagcaacaacgatccgcgcttcgacgg

Exon  9 +      14261      14456   1   Internal    196    98   Excellent
gcagaggacggcgacctctacctcaatgactactgccaccgcggtgcgcagggacgacgc
gcaggccggccgcggggcgggtggggaaggggagatggaggcgcagggccccggcaggtg
ggggggatcagaggcgggtagaccgcctgtcttactagtgtcttcccgctgcggcgccag
GCTTGCGGCTGCCCACCAGCAACAACGATCCGCGCTTCGACGGCGAAGACGGGGATCCTG
AGGCCGAGATGGAGTCCGACTGCTGCCCTTGCCAGCACCCACCTCCTGGTCAGGTTCTGC
CCCCGCTGGAGGCGCAAGAGGCCTCGTTCCAGAAGAAGTTTGAAAACTTTCTACACAACG
CGATCACCATCCCCAT
gtgcgaagagcgcgcgcggcctgggagggtctgatgagtggggcctgtgaggggcgggtc
ttgcgggaggggtggggtttgtgggtggggccttgcttgtgtgggcgggtcccgggttgt
gggtgcttttggaggcggtacgcgctgcagagggcacaggggtgcatccggacaggcctg

Exon 10 +      14779      14999   2   Internal    221    98   Excellent
cgctgcagagggcacaggggtgcatccggacaggcctgatagggctactcctggcctccc
cagatccccttggaaggtgacgtccatcaacaagagcccccaaaggtgagcaggactagg
gcaggtgctgaggggcgtggctttgggggctgggccttggctctgactcgctctccccag
GGACTCAGGGCGGCACCGCCGGGCAGCTGGGCCCCTCCGGCTGGGGGGCAACAGCTCGGA
TTTCGAGATCCAGGAGGACAAGGTGCCCCGTGAGCGAGCGGTGCTGAGCGGCCTGCGCCA
CTTCACGGAATACCGGATCGACATCCATGCCTGCAACCACGCGGCGCACACCGTGGGCTG
CAGCGCCGCCACCTTCGTCTTTGCGCGCACCATGCCCCACA
gtaggtgatccacacacacaccttctacccccatcaccgaccccaaggaccctgtgcaaa
ggtttggggtttgacttctcgctaaccccagagcctcgctttgcttgcccctctcagttc
ccataatcccaaagctttccccacctcccagctcagcccagtttagcttgggtttgaaca

Exon 11 +      15232      15378   1   Internal    147    89        Good
tgtgcaaaggtttggggtttgacttctcgctaaccccagagcctcgctttgcttgcccct
ctcagttcccataatcccaaagctttccccacctcccagctcagcccagtttagcttggg
tttgaacataaggtgagatgaaccacttttggcccggctgctggatgccccttcccgcag
GAGAGGCTGATGGTATTCCAGGAAAGGTGGCCTGGGAGGCCTCCAGCAAGAACAGTGTCC
TTCTGCGCTGGCTCGAGCCACCAGACCCCAACGGACTCATCCTCAAGTACGAAATCAAGT
ACCGCCGCTTGGGAGAGGTAGGTGCCC
gtgggacccccgtcccagccccgttttgtgcctacatcgccttcccagccagctgttctg
cgttactctcaggaggccacagtgctgtgtgtgtcccgtcttcgatatgcgaagtttggg
ggagtccacctggccctgctgccccctggaaactactctgccagggttagggcaacctca

Exon 12 +      15795      15900   1   Internal    106    93   Excellent
tatacacagcctctgtcacagacctgtatcaccgaacagccctacctggtccccagccca
ccacaggcccctcccccgcatccctccccatcctcacctcccagcatggaaagagaagca
tgaccttccctctgacttctacatctttgactctaccctctgctgccctctgactgccag
AGGAGGAGGATGCTGGGGGGCTGCATGTCCTCCTCACTGCCACCCCTGTGGGGCTCACGC
TGCTCATCGTTCTTGCTGCCCTTGGTTTCTTCTACGGCAAGAAGAG
gtgatgataagtcccaccggtccccacccccttttctccctgagccctcatcataaagtc
tgtcaaagggaggtagatgagacagtagaaagacaggtcttccatacaggcagtaactct
tcccctgcggtggcacagaggaaacatacctctcagttagggtgaccaactcatcccggt

Exon 13 +      16596      16648   2   Internal     53    73        Good
aggaatagggccaaggccaacttggagggtacttagggatccccaggagtcaccctgacc
aaggctgggggtgtggtcagtaacttccctcctccttgaaatgtccttcttccttcttct
gatgttgctcattccttcctgagaacccttccagcctgaccccctcacctcccgttgcag
AAACAGAACCCTGTATGCTTCTGTGAATCCAGAGTACTTCAGCGCCTCTGATA
gtaggtctgggagtgggtggacaggtggtgtgggaaagggagacaggagaggagcagaga
cagacttccagaagaccttcttgcagaagatagccttgggacaagagcccttcagaagag
gagaagagaagttggggggtgaggtgtggcagagagcagcatcctcgctttgtgaccctc

Exon 14 +      16842      17071   1   Internal    230    71        Good
tgggtggacaggtggtgtgggaaagggagacaggagaggagcagagacagacttccagaa
gaccttcttgcagaagatagccttgggacaagagcccttcagaagaggagaagagaagtt
ggggggtgaggtgtggcagagagcagcatcctcgctttgtgaccctccacctccttgcag
TGTATGTCCCTGATGAATGGGAGGTGCCTCGGGAGCAGATCTCGATAATCCGGGAACTGG
GCCAGGGCTCTTTTGGGATGGTATATGAGGGGCTGGCACGAGGACTTGAGGCTGGAGAGG
AGTCCACACCCGTGGCCCTGAAGACGGTGAATGAGCTGGCCAGCCCACGGGAATGCATTG
AGTTCCTCAAGGAAGCTTCTGTCATGAAAGCCTTCAAGTGTCACCATGTG
gtaagggagagccaagggcattgtcagggtcataattagtgtaaaggtcatgtggtaaga
aagaaagggtcagagatgaggttagggcaccattaaggtcaagattgggaccatggttag
gatcctaattggggtaaaggtcatggttagggttagagtcaaacagggtcatagtagggc

Exon 15 +      17567      17677   0   Internal    111   100   Excellent
atgatgaaggtcatgggttagggtcagggtcattgttaggtcaggagtcaggttatagtc
atggttggggttagggtcaggtttggtgtctgagtcagactgtggtcatagcagatcaga
attttggccaaatgggtcaaggggaactagggggtctgctaggccctttgtctgtcccag
GTGCGTCTCCTGGGTGTGGTATCTCAGGGCCAGCCAACTCTGGTCATCATGGAGTTAATG
ACCCGTGGGGACCTCAAGAGCCATCTTCGATCTTTGCGGCCTGAGGCAGAG
gtagggaccaggaagaccctggggagtgaaagaagggttgggcacagtgtgggaggtggg
ggccagttctggacaggagaccagcctctgggttccttcctcaccagcccccaatcttgg
ctctagaacaaccctgggctcccacagccagcattgggggaaatgatccaaatggctggt

Exon 16 +      17825      17972   0   Internal    148    92   Excellent
agccatcttcgatctttgcggcctgaggcagaggtagggaccaggaagaccctggggagt
gaaagaagggttgggcacagtgtgggaggtgggggccagttctggacaggagaccagcct
ctgggttccttcctcaccagcccccaatcttggctctagaacaaccctgggctcccacag
CCAGCATTGGGGGAAATGATCCAAATGGCTGGTGAGATTGCAGACGGCATGGCCTACCTT
GCTGCCAACAAGTTTGTGCACCGAGATCTAGCAGCCCGCAACTGCATGGTGTCCCAGGAC
TTCACCGTCAAGATCGGGGGTACAGAGG
gtgccaggcagatgagggcggcctgaaaagtagagagactcccttaagctaggcatcagg
agacccacagccctggtcctgacagcctgtgagacccttggcaagtcacccccaccctgt
atcttagtctcttgtccaagggcagaggggtttggatgggatgagttctgaggtccattg

Exon 17 +      18281      18410   1   Internal    130    96   Excellent
ctcttgtccaagggcagaggggtttggatgggatgagttctgaggtccattgagccccta
ctttccagggttcttggtgactctggaggatgagaagattgggagaggtatcccaggggc
aggagctagtgcgtggctcttatgccccacacctcctccaccctcaccctcactttccag
ACTTCGGGATGACTCGGGACGTGTATGAGACAGACTATTACCGCAAGGGTGGGAAGGGGC
TGCTGCCCGTGCGCTGGATGGCCCCCGAGTCCCTCAAAGATGGGATCTTCACCACCCACT
CGGATGTCTG
gtggggccgagctggagcacagggctccagggatgtggaggcgggatctggggaggggcc
tggaacacccccatcccttggaatgcactgagtagcacgaagggtgctgggctcaggagc
tcctgcatgcccccaggtcctttggcgtggtactctgggagattgtgaccctggcagaac

Exon 18 +      18547      18681   2   Internal    135   100   Excellent
gagtccctcaaagatgggatcttcaccacccactcggatgtctggtggggccgagctgga
gcacagggctccagggatgtggaggcgggatctggggaggggcctggaacacccccatcc
cttggaatgcactgagtagcacgaagggtgctgggctcaggagctcctgcatgcccccag
GTCCTTTGGCGTGGTACTCTGGGAGATTGTGACCCTGGCAGAACAACCCTACCAGGGCCT
GTCCAATGAGCAGGTGCTGAAGTTCGTCATGGATGGCGGGGTCCTGGAGGAGCTGGAGGG
CTGTCCCCTTCAGCT
gtgagtcacctcccctgccccttcctcattgttgatctacctacaaccctcccccacccg
gccccatgattctggctcacctcctctgatgctttgacatccactgaccctcagctatga
gcgccacccccctatcccaaacccccaagactcccatttaatcccttctcaccctcccag

Exon 19 +      18971      19202   2   Terminal    232    53    Marginal
ctcagctatgagcgccacccccctatcccaaacccccaagactcccatttaatcccttct
caccctcccaggcataatggcccacgatccccactcccaccaactgaccctcagtgcagg
aggctgagagcgtggcaggggctcccggatgcctctgaccctgctccccacacccaccag
GCAGGAGCTGATGAGCCGCTGCTGGCAGCCGAACCCACGCCTGCGCCCATCTTTCACACA
CATTCTGGACAGCATACAGGAGGAGCTGCGGCCCTCCTTCCGCCTCCTCTCCTTCTACTA
CAGCCCGGAATGCCGGGGGGCCCGGGGCTCCCTGCCTACCACCGATGCAGAGCCTGACTC
CTCACCCACTCCAAGAGACTGCAGCCCTCAAAATGGGGGTCCAGGGCACTGA
ggggcacctcattccctggctggcctcccatggggagacaggaagggacccgacctctgt
ggctgagacgcctgaatgttcacccccaccccaactcagggcaagggatggccgagggtg
gggcagagaacaggagcagggaaggctgtgggggtgggcagaggggtctcaccataggag

--------------------------------------------------------------------------------