--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (25750 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        424        525   0     Single    102    48    Marginal
ggggccaggcaaactctccccaggggcaggaccctccaatcgtgtccaccctgaccagag
tccaggccccagggcccttctaccttctccaggccctgcaggaaggagaaaaccatttcc
taaacacctgtcccttcattcacacgaagctcatgtgcagatcctgccctacgtggcaaa
ATGATGGGAGAGCAGCCTGAATCTTCATCGTCCCGAACCAAAGCCCCATTCATGAAGTTC
AGCCCCATCTCTAGCACAGCAGAAAGAATCACTGAAGTTTGA
gttccattttttttctaaacttttgcagatcctagacccaaaggctcaaggtaagagcgg
ctgggcttcctcacccccaacggcctctctaggggagagctgttcccaagcccaccccaa
gcgtggggacctgccttgatatggaggatcaaggaggagcatcgggtgccctcaatctcc

Exon  2 +       1240       1282   0    Initial     43    71        Good
tccagagcacacagggccaggacacctttgtacccctgctccccaccggcacaggtccca
cccacccccttctccccgccccatgcccgggtggagccagctgccagggcgccaagactc
ccagccctctctctgtgcacggcagagtagaggccaagggagggctctgtgccagccccg
ATGAGGACGCTGCTGACCATCTTGACTGTGGGATCCCTGGCTG
gtgagtgcccatctaccctgtggtcagacctcccttatcccaggggccaacgatcagggt
catctccccagcaccctccccagcccgagcatagccagtttcagtttctcccctgctagg
gctgagcagggtgccgggtgttcacggagaagcaaatgcccagcttagtttgctgggggc

Exon  3 +       5608       5740   1   Internal    133   100   Excellent
tgctggtccatttgtagaaggctgggggccagggtctccctgcccacccaccaggctggc
atcttgaaagcaaaggcactttgcatgaaatttatatggggcaggactctgactgagccc
atacatgggcagggtgaccctgggaaagcccctgctcaccctcctcccaccctcctgcag
CTCACGCCCCTGAGGACCCCTCGGATCTGCTCCAGCACGTGAAATTCCAGTCCAGCAACT
TTGAAAACATCCTGACGTGGGACAGCGGGCCGGAGGGCACCCCAGACACGGTCTACAGCA
TCGAGTATAAGAC
gtaggcttctctcttgaccccacctcctttgactgatctgaagccagcccctctccaagg
aattcccctcctctccatatgttcccatgtccccaccaggactggtgtcacatagcccct
cccagataaagctttgctcctttatgtttcttttgcagagggagaataatataagggtaa

Exon  4 +       7013       7191   2   Internal    179   100   Excellent
agaagaatgcatatgcctcagagaatcattgtgagaacaaaatgagatcattcgcataaa
gggcctgggccactgaacgtgctaagtaaatatcagatctccttggcattattaataagc
cacaggcctagcgctggccttttcatcaccacggtgacttggccccttcctgacctgcag
GTACGGAGAGAGGGACTGGGTGGCAAAGAAGGGCTGTCAGCGGATCACCCGGAAGTCCTG
CAACCTGACGGTGGAGACGGGCAACCTCACGGAGCTCTACTATGCCAGGGTCACCGCTGT
CAGTGCGGGAGGCCGGTCAGCCACCAAGATGACTGACAGGTTCAGCTCTCTGCAGCACA
gtgagttggagcccctgtgggtttcaggggagggaagaggaaagcgcaggtgtttgcggg
gtgggatggcctcttcccctctggagtgggtggagggtccagaaggggctctctgcaagg
ggaggggcagctggggatgtggcttttagggaagccccccacccccaccaattacagtgt

Exon  5 +       9936      10117   1   Internal    182   100   Excellent
ccagggcttgtagaaacttttctcttttcactgtttgtttagccgttgctttcagaagca
tagctggcactggagtggaaggagagagggagcagtcattttccactgtccaaggttgcc
tcagacactacccaccgattctgactttttcttttctcttttctctctccctatccccag
CTACCCTCAAGCCACCTGATGTGACCTGTATCTCCAAAGTGAGATCGATTCAGATGATTG
TTCATCCTACCCCCACGCCAATCCGTGCAGGCGATGGCCACCGGCTAACCCTGGAAGACA
TCTTCCATGACCTGTTCTACCACTTAGAGCTCCAGGTCAACCGCACCTACCAAATGGTGA
GT
gtatgttgcaccctggtctttctctgcctaggaagcctcttccctcccaattagatctga
gttgctttaagaaaaaaaggggacatgttatgtaaattagcatttcccaaaacatgtccc
ttgagaggctccttgaagcctggaaatcatcacaaatgacaacttttctcttgtagattc

Exon  6 +      15190      15305   0    Initial    116    86        Good
cacatcggtgctcacagcagccatgggttcagataagatcactaagtggctggagagtat
gtgagagagaaggaaatggttgaagagcaaatcttgcagaacaacattgaggggctaaaa
ccagcgaaagaccagtcagagaggtaggaggagagccagacaggataacatgtggcagcc
ATGGGAGAGGAGTTCTGGGTCAAAAAGGTGAGAGATACACAGAAGAACGAGAATCAAAAC
ACAGTTCCAGCAGAAGGATTGGCAGATGCAAAGAAACAAGGGCTTTCTTATGCAAG
gtaggtgtttacccgagtggcaggtatccagcattgatgagcctgcagagccaggtgggc
tgcagagacaaatgagtctggactggaagccaggcaccaggactctattctgtaaatatg
ggtgaggccatcaaagccttttgaatagaagagcattataatgagattgtcttttagaaa

Exon  7 +      16043      16181   0   Internal    139    90   Excellent
acgtgcttggagactgattggatttggggataaagcagaagggaggggaatggaaacaga
ggctgaagacagacccatcagcatcaaaccagaatccaggaggagcgagcaagcttcctt
gggctctatgtggagatcggtgtgtaacaggaatcacattccattctctgtccaattcag
CACCTTGGAGGGAAGCAGAGAGAATATGAGTTCTTCGGCCTGACCCCTGACACAGAGTTC
CTTGGCACCATCATGATTTGCGTTCCCACCTGGGCCAAGGAGAGTGCCCCCTACATGTGC
CGAGTGAAGACACTGCCAG
gtgagttcggctgaaaccagagggaggtggggctcccgaattcaagtcttgactcttctc
tttcctccctgtaaccaaggtgagacttggcaacactctagaaaaccatggaagggttat
cagtgtgttattgaagtcaatctttgtttatccataaaagagttggctgatgagttatca

Exon  8 +      20422      20482   2   Internal     61    53    Marginal
ctggatcctgtgacctcctttctagatcacattgtgagtacctgggaccctgaaactctc
tgtacatatggcccagagcctgtgatccgtctaggcagtcctcttttgggggtacttcct
catgagggcagacactgctgacatgtagtgcagacccttggcccaaaggatgaccaacag
GTGGCTATTTGGAGGGGACATGGATGAGCTCGACCATGAGGGCTGGGGCATCTATACACA
T
gtgcgtgagggccctggcagtgtgggatggaactgggctgggctgggctgggctgggggc
ctgcagtgcgctgcgggctttccctgtacctccccacttcagcacagtacctagagaagt
ccaagaactctgaattaaaatatggcatcccaggtggttgtaaaaaatctttttgttaag

Exon  9 +      20899      21020   1   Internal    122    97   Excellent
ctgactatttagatgtacagtatatggacttccatttgtgatcttgcattctgacggtag
gagaggccttgccagcccagccagagagggttttcagcatccacatgtggggccagaccc
aaccgggcccaggcagagcccagcctcacgcttccttctctggcccctttggtttcccag
ACCGGACATGGACCTACTCCTTCTCCGGAGCCTTCCTGTTCTCCATGGGCTTCCTCGTCG
CAGTACTCTGCTACCTGAGCTACAGATATGTCACCAAGCCGCCTGCACCTCCCAACTCCC
TG
gtgagccatccccccagggtgggagggagaggtccaggggagggcctgggctccgaggtc
cccagttgtccccaaaatgcagggatccacagacaaagcaggagatgggcctgctctctc
cattcacggagctcacagtcccagctaaagtcaacggacgtgtagcccagcaggtctcag

Exon 10 +      22585      22893   0   Internal    309    62    Marginal
ttcagagaggcacttgcacctagaggagtctctgggaagcagatggggatatgggacaga
cgcatcttgaaaaagcccccagatgcctccctatggaggacctcacccacccacatcacc
agtagggagcttgggacttaccctaaccacaggggggtgactgttgtcgtccctgcacag
AACGTCCAGCGAGTCCTGACTTTCCAGCCGCTGCGCTTCATCCAGGAGCACGTCCTGATC
CCTGTCTTTGACCTCAGCGGCCCCAGCAGTCTGGCCCAGCCTGTCCAGTACTCCCAGATC
AGGGTGTCTGGACCCAGGGAGCCCGCAGGAGCTCCACAGCGGCATAGCCTGTCCGAGATC
ACCTACTTAGGGCAGCCAGACATCTCCATCCTCCAGCCCTCCAACGTGCCACCTCCCCAG
ATCCTCTCCCCACTGTCCTATGCCCCAAACGCTGCCCCTGAGGTCGGGCCCCCATCCTAT
GCACCTCAG
gtgacccccgaagctcaattcccattctacgccccacaggccatctctaaggtccagcct
tcctcctatgcccctcaagccactccggacagctggcctccctcctatggggtatgcatg
gaaggttctggcaaagactcccccactgggacactttctagtcctaaacaccttaggcct

--------------------------------------------------------------------------------