--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (14844 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       8015       8176   0    Initial    162   100   Excellent
gaaacctacctgaatgcaggtgttgtgaggggagaggaggccccattatgggggagtgtc
atgaggggaaggaacctgcaaccccgccctgtgtgtggcaggggagggggcagctgtggc
tgaggcagggcctttccctggacccagtcggaggaatccctctgtcccacaggccccgcc
ATGGGGAAGACCAACAGCAAGCTGGCCCCCGAGGTGCTGGAGGACCTTGTTCAGAACACT
GAGTTCAGCGAGCAGGAGCTGAAGCAGTGGTACAAGGGCTTCCTGAAGGACTGCCCCAGC
GGCATCCTCAACCTGGAGGAGTTTCAGCAGCTCTACATCAAG
gtgggcggccggcacctggtgtgagggagccaagtacccgggttgggggaggcgaggaac
cgggggtgagggaggcagggcaccctgggatgagaagaggcgaggcacccggggtgggag
gggaggcgaggcacccggggtgcgggggaggtgaggcacccggggtggcgggggcaaggc

Exon  2 +       8466       8705   0   Internal    240    98   Excellent
cggggtgggaggggaggcgaggcacccggggtgcgggggaggtgaggcacccggggtggc
gggggcaaggcacccggggtgggaggaggcgaggcacccggggtgcaggggaggttccct
gagatgggggcggggtgggcggggctgtcgctgcgccccaacccaccgcacccccctcag
TTCTTCCCCTACGGCGACGCCTCCAAGTTCGCGCAGCACGCTTTCCGCACCTTCGACAAG
AACGGCGACGGCACCATCGACTTCCGGGAGTTCATCTGCGCCCTGTCGGTCACCTCCCGC
GGCAGCTTCGAGCAGAAGCTCAACTGGGCCTTTGAGATGTACGACCTGGACGGCGACGGG
CGCATCACGCGCCTGGAGATGCTGGAGATCATCGAGGTGCGGGGCCGCGCGGGCGCTGCT

gttcccgaggccagcgcttcgccatccccgcccctgcctccgcgctgctctcgggcttcg
gggcctccctgctgctccccagcctgcgatcccgcctcctaccaccccgctacaggcccg
ggctaaatgctttacccgacactcgacggggcggaggggttggttactgtcccaaacccc

Exon  3 +       9885      10049   0   Internal    165   100   Excellent
gaaactctgtttcaaaaaaaaaaagagttgctcattaaatatccagtcttaatgaccaca
tataccttccagtatcctcaccaacccccagtgttctccctgccagatccctttccttca
cccgctgcttctcggggccccttgtgggtgttcacacctccctcctccttccctcaccag
GCAATCTACAAGATGGTGGGCACCGTGATCATGATGCGCATGAACCAGGACGGGCTCACG
CCCCAGCAGCGTGTGGACAAGATCTTCAAGAAGATGGACCAGGATAAGGACGACCAGATT
ACATTGGAGGAGTTCAAGGAGGCAGCCAAGAGTGACCCATCCATT
gtgttgctgctgcagtgtgacatgcagaagtagaagctggtgaggggcagggtccctggc
cagaaggggcatggccacctcccaacctgatgacctctctggctggcctcccaggaggag
ggacactccagcccccctctctggcccacccagtcctctgcccaagcccttcctcccctc

Exon  4 +      11293      11337   0   Terminal     45    69    Marginal
acctttttcaattcaacaagcaactttctgctacatacttactccggttgggtgctgact
tcagggacaggaaaaagcaaggtttgcaaagagtgaaactagtgtatattccgtatcttg
gtagttcgtttctggattgggtttagtttcagaactggacttgttccttcactgccacag
AATCAGAAAGAGCTAGAAGAAAAGGCTCACCTGGCCACTGTTTAG
gcacccagacataatttatggacgaaatgcctaaaaatgtgccaggcatgctctgtttga
gaggctttttctaaccccaaatcttagatctgccaggtagttcaacatcttccaagtgtg
ctggttctgctttccaatgcctgcttcccaattttggatccatgagctatacagctgcat

--------------------------------------------------------------------------------