--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (40186 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       7026       7312   1   Terminal    287    50    Marginal
ttccccaaacctgggtctttcccagtgagctctctctcaataaatgacaaactgtccatt
caggaatgaaagccagaaacctagcagtcatctgttacattttctattgctgtgtaataa
accactccaacatttagtgacttaaaacaataataatcatttattttcctcttaaattag
CAATTTGGATGGTGTTTGGCAGGGACAGCTTGTCTTTGCTTTATGCTTTATGCTGGGTTG
GCTTAACCGGCATTGGAAGACCCACTTCCAAGGTGGTGCACTCACTGGCTAACAAGCTGG
TATATAGTCTAATTCCTCTCTCCAGGGGCCTCTCCACAGACAAGCTTGTGCCTCCTCATA
ACATGATGGCTGGATTCAAGAGTAAACATCTAAAGAGACAAGAAGTTAAAGCTGCTAGTT
TCTTAGGGCAAAGCCCAGAAACTGACCCAGCATCACTTCTGCCATAG
tctattgagaagcagtcacagaacccaactcaaaggagagaataagaacaccttttgttg
agagcagtttaaaagaatttggggaccacattttaaaaccgccacatcacccttgatctc
tttatcccccacctacaaattcagatcatcactttgtgtgatgattttagctctccagca

Exon  2 +       7713       7800   2   Terminal     88    84        Good
ctcatgctccacactgcctctcctaagctactgccacagctgcctcacttgtctcctgag
cctgtttgcccttctcctaactgctgtccaccctggagccagaatgatcttgtaaaataa
aatcatgaccatgtcaccacctctgcttaaagcccttccataacttcccatgactattag
GATAAAGACTCAAATCGTTGTCATGGCCGATAAGCGCCAGGCCCAGCCCACATTTCTGGC
TGCACTGGCCATGTATGGTGTGATTTGA
gttgcttgtaagaggatcttggtgggggcaggcaatctggctgaaagggtggatagcagg
atttgtcctcaactacttggatgagacaaggatgctgtttttacttgtcctgtatttgga
caagtttatttggattgacagtgggaggctaaaggatatcatatggggaatcatacaccc

Exon  3 +      11651      11795   0    Initial    145    88        Good
tgttatgattccttccttgcaggtaaaggcgcttgcacttctaacctgtatacccctgga
ggttaacacattgatacattattagttagtaacaccttacagtaaattagcttatccgat
ggatgctcttcttgagcatcagaagagctcagccttgacaaggagagtaggggagagagg
ATGGAAGAAAGAAAATGTCTAGAGCATGACGGGCACAGGGCAAAGGGAGTGACTGGATGG
GAGAGCCACAGCTACTGGGAGGAGGGTGGGCTCTGGGCAACTGGAGACCTGATATTCAAT
GCCAACCTATACAAGGAAGCGGAAA
gtgaggtagctggaagactctaaaaatgagcttcacttctcaacttcctaatcccagctt
agatgtcctacctggtgctttggtctcattcactgagtacggatgcaaagacccccagga
gagaaaatgagggatgcagtgctaataaggataaagcctgtggaaaaaagtaaaagaaac

Exon  4 +      17502      17668   2   Internal    167    66    Marginal
gtagctcaactctgcacccctcagcatcagttccaacagctaggtggctgggtttgctca
ctcccatgtctgggagttgaagttggctgtcccaaaggacctcagttggtgtcccaaaca
cagacacctgtctttccatgtggctgcttacctcccttcagaatgttgatggttttccag
GGTGAGCATCGCAAGGGACCAGGTGAAGAGAATGGCCTTTTATGAGTTGGCCTCAGAGCC
ACATAACATCCCTTACACTGGAGTCACAGGTGCACCCAGGCTCGAAGAGAAGGAACACAG
ACCCCACCTCCTGAGGGAGGAGAGTCAACATCACGTGGCAAGAGCAT
gtgtgataaaatatgctagtgtggccacattctttttcctaaccttgttctgataaactc
atacgagataaactcctgtgaaaatatggtccatctctttacctcgatataatcttattc
ataaaattctttaccacatacaaatgttccataaatacttgttaaatgagagaatacatc

Exon  5 +      18089      18238   2   Internal    150    95   Excellent
gtaataaaaatacttacacatggtatctccattaattttcccaataaatcaaggaaataa
gtattagagctcctattttattgatgagaaaactgacgctcagacaagttgacacagctg
gtaagaagtagggctgaggttcagggccaggcaattcatcatgctgtggggtggagtcag
GTGGACCAAGGCCCATGTGTTTGTCCTCATCGCAGTCTTGGAGGAGAAGCTGGTTGCCAG
GGCCAAGGTGGCCAAGATGGCTCTAGCTGTGGCTGGAGGTGCAAGAACAGCCCTGGACAT
TCCCTCAGTGGTCCTGTGGGCAGTGAGTGG
gtatgtctgtccgtgtcgcttacttttcccttccactgcctactttctttccagtcaggg
tgaccgtcgatgccatctctgtggaaactccgcaggacgttcttcgggcttcgcagggaa
agagtgtcaccctgccctgcacctaccacacttccacctccagtcgagagggacttattc

Exon  6 +      18297      18510   2   Terminal    214    85        Good
atcgcagtcttggaggagaagctggttgccagggccaaggtggccaagatggctctagct
gtggctggaggtgcaagaacagccctggacattccctcagtggtcctgtgggcagtgagt
gggtatgtctgtccgtgtcgcttacttttcccttccactgcctactttctttccagtcag
GGTGACCGTCGATGCCATCTCTGTGGAAACTCCGCAGGACGTTCTTCGGGCTTCGCAGGG
AAAGAGTGTCACCCTGCCCTGCACCTACCACACTTCCACCTCCAGTCGAGAGGGACTTAT
TCAATGGGATAAGCTCCTCCTCACTCATACGGTAAGGATACTTTACAAGTTCAGGCAACA
TGGGAATGATTATCACCTGACCAGGACCTCTTAG
aaggcaagcactatgaagtctttccataaatggtagaataaacactagcacccaggctgg
agtgggtggggagggagcagtgaatgttgggctcatggagggccagagtatgtcaccttt
attttgaaaatgtcacctgcccctaaaatatctttctggtggccaatctcaaatgaccta

Exon  7 +      22129      22305   0    Initial    177    45    Marginal
atggctagcacttctagaaacttaacatgtcacataatgccctaactgctttgtgtatat
tactactgtaattctcactacagtcctgagaggcaggtgttattgtcatcatctccattt
tgcagaatagttaacagaatcactggtggaacattttgctcaaggtcatacaattagtac
ATGGCAGAATGGGGATTTGAATTGAAGCAGTCTGGCTTGAAAGTCTGTGATTTAGCCATT
ACCACATACAATTTGATAAATGATGAGTCTATCAATCAATCAGTACATTCCAAAGGCAAG
AGTCAAGAAAATAAAGTGGGTTTGGCAGCCAAGGCTGGCTGCCCAGCATCATGCCTG
gtacatggaaggtgctcagtaaatactgatagactgaatgagtgaggataggctatggag
aaaatggaatggataagagagatgccggagattacaagaggtgaaagtgctgggatccca
gatggacccattcacccacatgtgtactgcggtatgaactgcctaacttctttcaatatt

Exon  8 +      22694      22910   0   Internal    217   100   Excellent
tatatataatacaagaaatccacaaatgggtagcacatatgcgagctatttgttctgagg
ggttggcaggtctgtgcttctgggccctggaaactgggggatgagggtagtcagggcagg
ctggaagcaccaggcaagggcctttgggtgaagacctggtgccatttcttctctctccag
GAAAGGGTGGTCATCTGGCCGTTTTCAAACAAAAACTACATCCATGGTGAGCTTTATAAG
AATCGCGTCAGCATATCCAACAATGCTGAGCAGTCCGATGCCTCCATCACCATTGATCAG
CTGACCATGGCTGACAACGGCACCTACGAGTGTTCTGTCTCGCTGATGTCAGACCTGGAG
GGCAACACCAAGTCACGTGTCCGCCTGTTGGTCCTCG
gtgagtgtcttcatgtctttcaggagttgtaggaagagggtgggcaggtggcagcacagg
gagaagagcccaggtgttgagacgaagccagaggcagcaacaaggagctaagactcctca
cctcgtccaggctgtcttcagcagagggaccgctcctccctttggaactaaacactattc

Exon  9 +      28095      28261   1   Internal    167    99   Excellent
tgaggccatattggggtgaattggttttacagcattccatctcactactcaactatggag
ttttctgcctgtgaacaaacaaggcagtatatgtgtgtggggggtgggtggggaggggtg
ggtggctgtcaccaagccccacctgcctcatgccttctctttggtctctcctctatatag
TGCCACCCTCCAAACCAGAATGCGGCATCGAGGGAGAGACCATAATTGGGAACAACATCC
AGCTGACCTGCCAATCAAAGGAGGGCTCACCAACCCCTCAGTACAGCTGGAAGAGGTACA
ACATCCTGAATCAGGAGCAGCCCCTGGCCCAGCCAGGTAAGGGGGCA
gtagggaaggcgggctccccacgtcaaagtgcaacacatgcagctgattggctaggggct
gcaacttgggttgaccgatcagatccccctgaaggccgcttgcttccctacccatcccta
tccccctatccccacctctctaagcactggtttcttgtttttagacagagtctcgccagg

Exon 10 +      31309      31387   0   Internal     79    68    Marginal
tcctgcctccacagggagactcttctggttgttagaagccaaaacttagttctttcatta
tccaaaagggagaatcctgaggacaggaaaggaggtgaaaagagaattgcttctttaatt
tgtgaaagctttaatttgtgaaagctttatcctgtctctagttaagatttgctgagtcag
AATGGGGACCTGCAGGTGACAGAAAAGAATATGGTTAATGTCCATAACAACATGCCCTGG
CATCTGGAGACATTGCGGG
gtgagggcagagttctcaaagccttcgtttccactctgctttgcagagccttggagaatc
tgccaattctggccaggtgcagtgtggctcatgcctgtaatcccagcactttgagaagct
gaggcgggtggatcgcttgagtacaggagttcgagacccacctgggcaacatggtgaaac

Exon 11 +      35983      36102   1   Internal    120   100   Excellent
tcacattgtgggccctgcctggtttaagcgtcctgcagccctggaggtggacatggggct
ccggcctgaagaagctcagtggcagaggttgtgcttcccaaggagtccagacctcccatt
cctggctgtctccactccactgtagtgcctctcttcaccctgactcttcttcccctgcag
CCTCAGGTCAGCCTGTCTCCCTGAAGAATATCTCCACAGACACATCGGGTTACTACATCT
GTACCTCCAGCAATGAGGAGGGGACGCAGTTCTGCAACATCACGGTGGCCGTCAGATCTC

gtaagagcagcctgcggggggagggctgacaaacgccacaggataactggtgggggtcca
gaaagtcagctgagaccaccgtgaggaggaataggggaacctctctagggccacgcacct
gcaggttagctgtggtgacctaggcaggatgactctgtcccaggctcccctcactctgag

Exon 12 +      36368      36437   2   Internal     70    67    Marginal
gaggaataggggaacctctctagggccacgcacctgcaggttagctgtggtgacctaggc
aggatgactctgtcccaggctcccctcactctgaggccagtccagttccactggtgtttg
gaagtggaacctaggactgacttctaggactcagaggctttgtcagtcccacctgcctag
GAACCACTCGGTGGGCGTGGAGGAAGTGCCCAGGGCAGCTGCCGCAGAGTCTGGACCACA
TCCTTCTGGG
gtgagacaccaaatctagcttaaagagctggctgggctgacatctgaggacttttgcaga
gccagggtagcccggaaagtgttaagatgtgaagtggaccatatgtctctgtctgcacct
ccatcctgaagaatattcctgggccatggctggtcacattcctccaagaccatgcctttc

Exon 13 +      36721      36856   1   Internal    136   100   Excellent
tgtctctgtctgcacctccatcctgaagaatattcctgggccatggctggtcacattcct
ccaagaccatgcctttcatggagtgttaccagaagctggtagctgctgctcccctggctg
ggaggagacccggagctagcttagaagctcggcaagtgcagctgctctgtcctcttgcag
CCTCCATGAACGTGGCCCTGTATGTGGGCATCGCGGTGGGCGTGGTTGCAGCCCTCATTA
TCATTGGCATCATCATCTACTGCTGCTGCTGCCGAGGGAAGGACGACAACACTGAAGACA
AGGAGGATGCAAGGCC
gtgagtgtctgggctggtagcctgttggaagggtctggggagactggaaatatgcttccc
aattcctcacagcctcttctacttgcagcaccccttggggtatatcacccccattttgtg
ctgatgaaacaatgacctgtccaagccataaaatgtgcattgcagccccaggacctgcct

Exon 14 +      37366      37469   2   Internal    104    99   Excellent
cgtggaacaagtctgtggcacctttactctcagcccagcctttcagcccagtgtcctctg
cagctggtgggtggggaggaggtctggaggctgctcttcctgtaatgcacatgaggccca
gctcccttgagggtccacctgagagcaaatccttcccctctgtcccctgctgccctgcag
GAACCGGGAAGCCTATGAGGAGCCACCAGAGCAGCTAAGAGAACTTTCCAGAGAGAGGGA
GGAGGAGGATGACTACAGGCAAGAAGAGCAGAGGAGCACTGGGC
gtgaatccccggaccacctcgaccagtgacaggccagcagcagagggcggcggaggaagg
gttaggggttcattctcccgcttcctggcctcccttctcctttctaagccctgttctcct
gtccctccatcccagacattgatggggacatttcttccccagtgtcagctgtggggaaca

Exon 15 +      37605      37660   1   Internal     56    95   Excellent
aggaggaggatgactacaggcaagaagagcagaggagcactgggcgtgaatccccggacc
acctcgaccagtgacaggccagcagcagagggcggcggaggaagggttaggggttcattc
tcccgcttcctggcctcccttctcctttctaagccctgttctcctgtccctccatcccag
ACATTGATGGGGACATTTCTTCCCCAGTGTCAGCTGTGGGGAACATGGCTGGCCTG
gtaagggggtccctgtgctgatcctgctgacctcactgtcctgtgaagtaacccctcctg
gctgtgacacctggtgcgggcctggccctcactcaagaccaggctgcagcctccacttcc
ctcgtagttggcaggagctcctggaagcacagcgctgagcatggggcgctcccactcaga

--------------------------------------------------------------------------------