--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (54897 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2659       2897   0   Internal    239    82        Good
cttattaaagtatttattagggtaatcctaattttgatacgtgtgttatttacgttacat
ttatctagaatttaaacagatttccttttttcatagataaatcaagaagttattgtattt
aatttttatttgcatatacttttttttgtttgttttttgggttttttttttttttgccag
CAAATCCTAGAAGAGCAAGACTTTAAAGAAGAGGATTTTGGCCTATTTCAGTTAGCTGGG
CAAAGATGCATAGAAGAAGGGCACACAGACCAGCTATTAGAAATTATTCAAAATGAAAAG
AATAAGGTGCGTACAATCTTGGTGTTTACTTTTCAGTCTTGGGAAGAGAATAATCACATG
ATGCTATTCATCCAGTCATTTATCCATCAAACATTTAAGAATCTACTTAAATTTTCACA
gtagggaactgaaaacaaaaaaagaattagaaatatttaggccaggcgcagtggctcacg
ttcgtaatcacagcgttatgggaggccaaggcaggcagatcacttgagcccaggagtttg
agaccagcctgggcaacagagtaagaccctgtctcagaaaaaaaaaaaaaaaaaagaaaa

Exon  2 +       8560       8779   2   Terminal    220    82        Good
gaggcactatttaaatcttgggaaacaccaacttgcctgataaaaagtaaagaccctttt
gcctttcctcagggaacatattaaaaactatttaaaaatgttgatgtctgttagtagcca
accctggaaagtctctggtgaaatgtcataggcttcacttgtctcatcttcctatttcag
AAACAATTCTGAGCTCTTCCAAGATAGGAAAGCACACTGCGAGAGTCCTATAGATGGCAG
TGTTTGCTTTACTCTGAAAATGTTTTTACAGGTCATCATCAAGAATATGGGCTGGAATCT
CGTTGGTCCTGTTGTTCGATGCCTTTTGTGTAAAGATAAAGAGGATAGTAAAAGAAAAGT
TTATTTTTTGATCTTTGATTTATTGGTAAAGGTAAGTTAA
caaaacaaggttctctttatcataacacacagcagtattttataattccctttaatgttt
attgtttggtaagaaagcttttggttcatgaaagtacatgcagaaaggaactcgttggag
aaaagacccagtcttattgattggataggcaattccatttcaggatttcccaaattttct

Exon  3 +      11144      11274   0    Initial    131    86        Good
aattccacatttgccgaatttcttgtcccatgtttagcatacttgatgagcgacaacttg
atctctgttttagtgattcagaaacttcataacaaggcatattcaattggattagcattg
tctaccctttggaatcagctatctcttcttcctgttccatactcaaaagaacaaatacaa
ATGGATGACTATGGCCTTTGTCAGTGTTGCAAGGCCTTAATAGAGTTCACTAAGCCTTTT
GTGGAAGAAGTCATTGATAACAAAGAAAACTCACTGGAAAATGAAAAGTTAAAGGATGAA
TTACTGAAATT
gtaagtataattttaagaacatctcacagtggacttaagtaattgatagttcagttattt
tatgtttcttcactttgtttgacatgtaaatagaaatctagtttcagattttgaatttta
gaagaatgtggggttcagttgatacagcatgggaacttgagacatttatattttaaaaaa

Exon  4 +      15841      15874   2   Terminal     34    81        Good
tttcttttagggtttttatggtgttaagtcttacatttaagtctttaatccatcttgagt
taatttttgcataaggtgtaaggaagggatccagtttcagctttctacatatggctagcc
agttttcccagcaccatttattaaatagggaatcctttccccattgcttgtttttgtcag
GTTTGTCAAAGATCAGATGGTTGTAGATGTGTAG
tgttatttctgaggcctctgttctgttccattggtctgtatatctgtttcggtaccagta
ccaatctgttttggttactgtgtccttgtagtatagtttgaagtcaggtagcttgatgcc
tccagctttgttcttttggcttaggattgtcttggctatacgggctcttttttggttcca

Exon  5 +      28572      28723   0    Initial    152    88        Good
ttgaaagcaagtctcataggtcccactcacgctcaaagggagtgattacacctccccttg
gtgagaatgtggagtttgaatacacggggtggggggcattttagagtctgtgtgctatgg
tttccttttttatccatttcatagggttttttatcagcaattggacaccctttccccaaa
ATGATTTTTAATCATGGAAGGAAAAAGAGAACTTGGAATTACCTTGAATTTGAAGAAGAA
GAAAATAAACAGTTAGCAGACTCAATGGCTTCTCTGGCATATCTAGTATTTGTACAGGGC
ATCCATATTGATCAGCTTCCAATGGTCTTAAG
gtaagagttagtgtttggtttattcatgtattctaaaaggaatttcataaaattctcatt
tatctaatgtccaatatatgcatattaacacactaatacattttaaataaatagtaaagg
ctatttttaataagaatgatcccagctataatctgttaaagatagcagtagacaagtaat

Exon  6 +      33595      33648   0   Internal     54    78        Good
tacatctgaattttacatttttttatttccagggcttagtgaaagtaatgacactttgcc
ccattgagacactggtatgtaaatatttggtgactaaagaataatgagttacagtgagaa
aatttgacaaataatttaattttctttttaaaaattttaatttgtgaaatttttatttag
GAGGTACAAGTGTGGATGTATTACATGCATAAAATGGATAGTGATGAAGTCTGG
gtaagctttattcattttatataataatattgtttgttccattttagaggaaaaagagtt
tagctatgcttcagctgtatattaacaagttggattcacaaggcaaatatacattattta
ggtatgtatcaagcatggctaattgctaagtgtgtggttgattaaaagtcatgttaatgc

Exon  7 +      37262      37355   2   Terminal     94    77        Good
attgtatgatttaaacaaatggaaaacagtgataagttattactactcaaaaagatatta
atggaaatagtttctattggcaaacctaattataaaaatatgaccaaagttttagcttat
tgagattgctgttgactatataaaaccatactgtaagtaacatatatttttaattaacag
GATTATGGCTTCATTAAATTTATTGAGGTATTTGGTTATCAAAGATAATGAAAATGACAA
TCAAGTAAGTGAAGTATTTGAAAAGAAACTGTGA
gtatattcaaaaggcataaggaatgtttcagatattcagtacctaaagccaatatttaat
atcttacccagatataaaggccgggaagagtgccaacaattattctgaaacctgaagtta
attcccaggagcatttaccaccccacatccagctttcctttccctttccatttcctattg

Exon  8 +      40583      40660   0    Initial     78    43    Marginal
tccccactgggtgacagagcaagagtctgtctcaaaaaaaaaaaaaaaaaaaagaaagaa
aaaaaagaaaaaacaaaatgatggtctggtgatgctgaaatatggggcattttattcaaa
aggactcctaccagtacctatttttgagcacttaagtgtgctaagagggtaattagtcag
ATGAAAAGCAGACACACAGTCAGAAATATGAACAGGAAGATTAAGAAGAGAATCACATTC
AAATACAAAGACAACAAA
gtgattcataattgagtaataatccatttcttttcttgctattttgggttactgtcaact
gacttattctcttcgtaagccctccttcctcaccctactatttcatgcctcttgtatctc
cttggttaagtttcaggcaccttctcttactcttgaatttcatataacttttcttgaata

Exon  9 +      52199      52310   0   Internal    112    63    Marginal
atttttcttttaattggtattcacataactagctatagtaataattattaaatagtgaag
tccattgtgaaaagcaagggccatgtttcatttatttttgttttttgagcttttatcgcg
tttaatagtaggcaatcaatcattgttgaactaaataactcattctttcattcttaacag
ACTGGATTATGGACAGAACTTGGAAATATTGAGAATAATTTCTTAAAGCCACTTCATATA
GGACTTAATATGTCAAAAGCACATTATGAAGCAGAAATTAAAAATAGCCAAG
gttggtaatgtgcaattttgttttcaattaggtctaaaaagtagtctaattttggaactg
tcatattcaaatttaagaactttttaaaaatcttgtactttagagaccataacagctaag
ccattttatttatagttaaaattcttagcagatctataagctaatttacctaaaatcggg

Exon 10 +      53044      53135   1   Terminal     92    47    Marginal
gaattttgatatttcattctgtttgcttatagcttaagtataccctgagctgttaaacaa
tggacttaataatttatacaaataactgacatgttttaagttagtgaatgaaagtagctt
atacctttgttattgaaatctgagagttaagtgtcacacatgatttttcttctcttacag
AGGCCCAGAAATCTAAAGATCTTTGTTCTATAACTGTAAGTGGAGAAGAGATCCCTAATA
TGCCTCCTGAAATGCAGCTTAAGGTGATCTGA
aattttcttttctttcctttttcttctttagaaacggggtcttgctatcttgcccaagct
ggagtgcagtggcatgattgtggctcactgcagcttcaactccctgggctcaagtgatcc
acccacctcagattcctgattagccaggactgcaggtgcacaccaccatgcctggctaat

Exon 11 +      53542      53658   0   Terminal    117    94   Excellent
actcctggcctctagtaatcctctcagctcagcctcccaaagcacaggaattacaggtgc
aaaccactgtacctggtcttaaatattcctaagctacctccagctgaaatcttttctgtg
ttttgctttgttttgctttaaaggcagcattaataacattactttttcttggcattgcag
GTCCTGCATTCAGCTCTTTTCACATTTGATTTGATTGAAAGTGTTCTAGCTCGAGTGGAA
GAACTCATTGAAATAAAAACAAAGTCTACCTCTGAAGAAAATATTGGGATAAAGTGA
aagttccatttcctaaataaaaactaataaaatatagtactttccattatgattcattta
atacctttataaaaaatttttctgtaaaaatttactgcttgaaaaataaatgtagctttt
ctcatttatcaatttctataatgatacactatagaacaggtttttttggttttaaagtta

--------------------------------------------------------------------------------