--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (53066 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      17687      17869   0    Initial    183    67    Marginal
cttatacctgccaagggcaagccaggtgcagagcagcaaggggtgtgtggacaagctagc
atggggtctggccactgtacacagccacgcacgctggggctgctgtggtggggtaggcag
ctccaagcataagcacagctgccggttctgtgtgagtctgcagctggaccagagtatcac
ATGCAGCTTCTGCTGCGGGTGCCCATGTCTGGACAAGGGGAACATGGTGGCATCCAGAAA
CTTGGAGACACCAGGAACCTCAGAACCCCAAAGAGGATGTCACAGCCCTGGCTCGGGGAG
ACCCTAGGTCTGAGCTCCACAAAGGGCCCCAGCTCTTCTCTCTTTCTGATTGCCTACCAC
ATG
gtgagcagggggtgtgtttcagccctgtttgcattacagctctttcagtcctgccatttg
gtgggttctgagttcttgtcccatgccccacgctgacaactgggggtgagcaaagtggag
aggagcttcactgagcaatagaacagctctctggagacccaaagtggatagctctttctg

Exon  2 +      19153      19529   0    Initial    377    74        Good
aaggacagaatttttgatcaaattttgctttgtacttgggcttgcaggaactgtggaagg
tgcatcagtgaagaaatggaccaatgtgtataatcatggaatctccttgctaaccatcac
caccagctctccttaatacatgagcaagagtgggtcaggggagaaggaaaagaggtcaac
ATGAAGCTAAAGCAGCGAGTCGTGCTGTTAGCAATTCTCCTTGTCATTTTTATCTTCACC
AAAGTTTTCCTGATTGACAACTTAGATACATCAGCTGCCAACCGGGAGGACCAGAGGGCC
TTTCACCGAATGATGACTGGCTTGCGGGTGGAGCTGGCACCCAAGCTGGACCATACCTTG
CAGTCTCCCTGGGAGATTGCAGCCCAGTGGGTGGTTCCCCGGGAAGTGTACCCTGAAGAG
ACACCAGAGCTGGGGGCAGTCATGCATGCCATGGCCACCAAGAAAATCATTAAAGCTGAT
GTGGGTTATAAAGGGACACAGCTGAAAGCCTTACTGATACTTGAAGGAGGCCAGAAAGTT
GTTTTCAAACCTAAGCG
gtaagttttgatcttggaagctgcatgtgctagttggttgattcatttaacttgggattt
atataagatttattttgtcatcttctcttggaagtctcttcagtaaaataagaggggtag
actagatctctaaagtcttttctagcacttaacatgaatctacctttatagtatcatata

Exon  3 +      25584      25670   2   Internal     87    94   Excellent
ctacctcatcttcattccatctaccggcaattcatgctaatccacagttgtttgcagggt
tgacagagaaggtgactatagcagaatcaggcttgctaatgggtgtattctaccacttgt
gctgtcacctgttactggtgtaatccacgtatacatctgtgcttcccattcactttgcag
GTATAGCCGAGACCATGTGGTGGAAGGGGAACCGTATGCTGGTTATGATAGACACAATGC
AGAGGTAGCAGCCTTTCACTTGGACAG
gtgcgtatgatcacagcagcttatgttcattttgtttgctttcaaaaatctttcttggag
aggactcgtggactccttcagaaggatgcaacactaataaataacttgttatcgatttta
gatagctaattgactagttccattaaacttgtatgagtctcataatttggttggcaccag

Exon  4 +      29834      29943   2   Internal    110   100   Excellent
aataaattatacacaccttcacattaaattcctaaatatatgtacctctaaaaaattagg
tttagctactagctaaaaaccctttacacatttgacatgatgaactgtaatttttaagac
tgttacttaaaaaacatcccctaagatttttctcttctgttcttcaatcttccaaaccag
GATTCTGGGTTTCCACCGAGCCCCCTTGGTAGTTGGCAGATTTGTTAATCTTCGGACAGA
GATCAAACCTGTCGCCACAGAGCAGCTGTTGAGCACCTTCCTAACTGTAG
gtaagaagattgtagaggacatttatataggggaatgattaataagttaaaatggggcat
tgttgagcaagctggctcatgacttttaggaattgaagaactcagtggaatacaaaagca
aatcagacaaccagctctcaggttatttgggaaaatgaatctaaaggagatggcaggaaa

Exon  5 +      33028      33135   1   Internal    108   100   Excellent
gtgttacccacattttatacctaagagtggaggcttagaagtgtctaatgactttcccaa
agtcacaaaactactaattgttagccaggatccaaactcagattttaagactctaaaatc
tttcattagcttatagtctttatttattcagtacgactttatttcacttctgtttgacag
GTACTGAGCTAGGTGCTGAATATGCAAAACTGAATGACCTTCTTATCTTCAAGGATCTTT
GTCTAGTGCGGGAGCCAGACATGTACAAAGGGGCTATGGACTGTTGGG
gtgggggtgggaatagggaggtggccaagaagttatggccaggtgataattcgtgaaggt
gatattttaaccaagtcttaaagggaaaatagcagtctcttaggtagatacagtgggaaa
gaatattttaggtttgtatttaacattttttgtgctatagatacctttggcagtctggaa

Exon  6 +      39232      39403   1   Internal    172    63    Marginal
tttacaccgtgtgcttttttattacctatacaggaaaataaatgtttgaaatatagtaaa
ctcagggtctttgttttcaccatgcttatttacttagctactctgttctgcattatttgg
gagagaacttggagtcttcgttatttccttaagtgtatttggctcctttctgtcctttag
GAAACAATACTTGTTTTTATGGGAAGTGCTATTACTGCCGAGAAACAGAACCAGCTTGTG
CTGATGGAGACATAATGGAGGGATCTGTCACACTTTGGCTTCCAGATGTGTGGCCTCTGC
AGAAGCACCGTCACCCATGGGGCAGGACTTACCGAGAAGGCAAATTGGCCAG
gtaaatgctcctatgagccattacttaattctcccctgtgcctagccaggtgccaactct
gtaaaggagccagcagttctgtccaagagtgaaaagaactgtggagtcaggggcaaaccg
gtaggtaggaactctgtcttctctttgtgtgtaacagtgccaggtacagtgttgtcactc

Exon  7 +      39610      39801   2   Internal    192   100   Excellent
aattctcccctgtgcctagccaggtgccaactctgtaaaggagccagcagttctgtccaa
gagtgaaaagaactgtggagtcaggggcaaaccggtaggtaggaactctgtcttctcttt
gtgtgtaacagtgccaggtacagtgttgtcactcagtgctgtgatgctgcttgtctccag
GTGGGAGTATGATGAGAGCTACTGTGATGCTGTGAAGAAAACGTCCCCTTATGACTCTGG
CCCGCGCCTCTTGGACATCATTGACACAGCTGTCTTTGATTACCTGATTGGCAATGCTGA
CCGCCATCACTATGAGAGCTTTCAAGATGATGAAGGCGCTAGTATGCTCATCCTTCTTGA
TAATGCCAAAAG
gtgagaccagcaggactgtccttgtcagggaggggtttctgtatatgaaagaagggcatt
ttccagagcatcctggagaatatccagaatgcaattgataggcaacatccttcttttttc
cacttggagtctttgctattggtacctgtccttctctccactctcagggatctcagtact

Exon  8 +      47218      47449   2   Terminal    232   100   Excellent
aacaatatcaaaacatagtaatgtggcttactcattatgtaggggtaattctaaagcaaa
aattatttagttaaaggattttacctaattattttttcacttttgtctgcctagcaggct
ttcaactccgtttgataatgagaagttttatgtaccttgttctataactttttctcccag
CATTCGGGTGTCCACCTGGAACAGACTGAACTACCTAAAGAATGGTGTGCTAAAGTCTGC
CTTAAAATCTGCCATGGCCCATGACCCCATCTCCCCAGTGCTCTCTGATCCTCATCTGGA
CGCCGTGGACCAGCGGCTCCTGAGTGTCCTGGCCACCGTGAAGCAGTGCACCGACCAGTT
TGGGATGGACACAGTACTGGTGGAAGACAGGATGCCTCTCTCACACTTGTAA
ttctcgacacaaaataagtgaaacttctttttacaaagatagagaaacagcacaatcaat
tccaaatggtatgagatggattggaagtggccagcagcaagttctggtgacgggacagag
tggccttggatgtctttggtattttctgtagtagaaactaaagcaaagaccacaagtttc

--------------------------------------------------------------------------------