--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11038 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +         76        120   2   Internal     45    54    Marginal
caaaagagaagagataagggacagatagccctaggtctggtttctgaacccttttcctga
acttctacttcctagAAAGAGAGAAGAGGAGAGCAAGGAACTGTGTGTGTCAGGATGCAT
gtgggtttgtgtgtgtgttgtgtgtggatggatataggtgtgtgcttgggtgtctctgtg
cctgatctctagcagtctgatagtaccctttcctatgtgtgtctggaaggtgtacctgtg
tgtccatatgtctgtgtcaggcacctgtgtctctatgttctctgcctttgggtgactgtg

Exon  2 +       1271       1398   0    Initial    128    83        Good
gggcctgtcgggggcgcgccaggggcggggcttcgggggcgcgcccaggagggcggaggg
aagggctgggggcgtggcctaaggctgggggccgacggcggcggcagcagggagctggga
agcggagaagccgggagcgcggggctcagtcggggggcggcggcggcggcggctccgggg
ATGGCGGCGGCTCCGCTGCTGCTGCTGCTGCTGCTCGTGCCCGTGCCGCTGCTGCCGCTG
CTGGCCCAAGGGCCCGGAGGGGCGCTGGGAAACCGGCATGCGGTGTACTGGAACAGCTCC
AACCAGCA
gtgagtcggggaccctgggagtccgcgcgtcccgtctcagtgagagggggagccggtggg
cccgagaagtcctgggggatcccggggtgggagtcctgggagaccagagctgggggctgg
gaggggacggagagggggacgcactctgtgggcgtctaggaaactcgggggtgtctgaag

Exon  3 +       6285       6364   2   Internal     80    77        Good
ccagtctctccccccagggagctcccagggactagggaccccgtggtatgacattttgcc
aaggaccccatgcctttctgtgtccaccactctccttgcactgccaagatatgtgcattc
ttacgctaaagaaattagggaaaactcctgccccctctccgagtttctttctccattcag
AGGTTTCTCCATCCCCACACCGCTCACTACTGCCATCGAGGGTGTTAAGACCAACACTTT
GATGGTGACTAGCAAGGCAG
gtggggattacaagggacccagcatctgcttctctgtcccaaagagggatcagggaaata
agaggcgcagccatcttgtctaggccctgtgcccactgctctgcccagcatcattaaggg
gggccgttgtgccaggttgaggaaggaggtgcacaatgagacagaagtttgggctggttg

Exon  4 +       7206       7264   1   Terminal     59    66    Marginal
attatgggggatggacggaggaaatccgggcctgggtctgagagtcgctggggcctgcgc
cgtttctgtggcaaccaaagcgtacgttcccttcttccctccgcccctctccctcgcctc
cttttctttggaggcaggccgggcttccctgcgcctttgctaccctctggtggccaacag
GAGAAGGACAGACCAAGAAGGAGGGCACGGAAGGAGACTTAGGGGAGCGGCGGCACTAG
ggccccgggggcagagacagggctgagccgcgaggaagctcggaggaaaagtcggaaggc
tacgcggaccctggggaggggctgcggagcggtcagatggaaagcggctttgctctgggg
tttcttctctctgagccgcttcctcttccccacagcctgcggcgagagggctacaccgtg

Exon  5 +       7542       7733   1   Internal    192   100   Excellent
tggaaagcggctttgctctggggtttcttctctctgagccgcttcctcttccccacagcc
tgcggcgagagggctacaccgtgcaggtgaacgtgaacgactatctggatatttactgcc
cgcactacaacagctcgggggtgggccccggggcgggaccggggcccggaggcggggcag
AGCAGTACGTGCTGTACATGGTGAGCCGCAACGGCTACCGCACCTGCAACGCCAGCCAGG
GCTTCAAGCGCTGGGAGTGCAACCGGCCGCACGCCCCGCACAGCCCCATCAAGTTCTCGG
AGAAGTTCCAGCGCTACAGCGCCTTCTCTCTGGGCTACGAGTTCCACGCCGGCCACGAGT
ACTACTACATCT
gtgagtgacggcggccgggcgggcgggtctgaacgcgagagtctgagtgacagccggggg
gtggagcccctaggctccggggcggggccggcgcggcgggcgccaggtctcgcggctgag
accagggaggaggcgtgggcacgggacgcctgaggggttcagctcagacgaggtcgtggg

Exon  6 +       8457       8534   1   Internal     78   100   Excellent
tagaataggctccgagccgcgcccccatcctcagctccctgctttggggctcccctggct
tcctgggggtgggggcggagggcacaggtgaggggggcttgctccccagccgtagcaagg
ggagggaatcctggccctgactctcccctcctctctccccacccgcaccccaccccgcag
CATCGCACTCCGGGGAGAAGCCGGTCCCCACTCTCCCCCAGTTCACCATGGGCCCCAATG
TGAAGATCAACGTGCTGG
gtgagtctgcgcagcgccctctggtggccactgctggaaccgcagccccccgccccggtg
cctgctcacctcgcatgccttccctgggggcactgatacttcctaccctgtgggtggtca
cgtccctggctccattgctgctgccgcgtgcccctgccctggcgcgcaacccagccctca

Exon  7 +       8457       8872   1   Terminal    416    94   Excellent
tagaataggctccgagccgcgcccccatcctcagctccctgctttggggctcccctggct
tcctgggggtgggggcggagggcacaggtgaggggggcttgctccccagccgtagcaagg
ggagggaatcctggccctgactctcccctcctctctccccacccgcaccccaccccgcag
CATCGCACTCCGGGGAGAAGCCGGTCCCCACTCTCCCCCAGTTCACCATGGGCCCCAATG
TGAAGATCAACGTGCTGGGTGAGTCTGCGCAGCGCCCTCTGGTGGCCACTGCTGGAACCG
CAGCCCCCCGCCCCGGTGCCTGCTCACCTCGCATGCCTTCCCTGGGGGCACTGATACTTC
CTACCCTGTGGGTGGTCACGTCCCTGGCTCCATTGCTGCTGCCGCGTGCCCCTGCCCTGG
CGCGCAACCCAGCCCTCACCAGTCTGTCTGTTCCTCTGTCCACAGAAGACTTTGAGGGAG
AGAACCCTCAGGTGCCCAAGCTTGAGAAGAGCATCAGCGGGACCAGCCCCAAACGGGAAC
ACCTGCCCCTGGCCGTGGGCATCGCCTTCTTCCTCATGACGTTCTTGGCCTCCTAG
ctctgccccctcccctggggggggagagatggggcggggcttggaaggagcagggagcct
ttggcctctccaagggaagcctagtgggcctagacccctcctcccatggctagaagtggg
gcctgcaccatacatctgtgtccgccccctctaccccttccccccacgtagggcactgta

--------------------------------------------------------------------------------