--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22276 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1377   0    Initial    177    67    Marginal
cacccacctgtagcgcccggggacgctcgaagcccgacctcccacgcccgccccggagcc
ccgcccctcccgcccctccccgcccttcccgactctccccgccccttcctgccccgacgc
gcagcaggccccgcccacccaggcggtaggaacccactccggcccgctagacctgctgct
ATGTCCCGGCCGCAGCTTCGACGCTGGCGCCTCGTCTCTAGCCCGCCGAGCGGCGTCCCG
GGTCTAGCGCTGCTGGCGCTGCTGGCGCTGCTGGCGCTGCGGCTCGCGGCCGGGACCGAC
TGCCCATGCCCGGAGCCTGAGCTCTGCCGCCCGATTCGCCACCATCCAGATTTCGAG
gtcagcgccttcctctgctcctctaggtctgggcttcagggcacgaagagaagttagggt
agaacggagccctaaggagaggtgccgtgggcgccgaaaccagctttgaccactcgatga
gggccttcctgtttacggatccttcaatttatagatgaggaagctcgggctcagagaagt

Exon  2 +       5477       5685   1   Internal    209    90   Excellent
taacttcagaacaattttactaatgatttataatggttattttggagattcatgagtaat
ggctttctgttactttggtatattctttctccattggaaaacttcagttaagggcttagt
cttccaaaataatgaaatgtttttgcatacatgttcaaaagatatatacttcttccacag
GAGATGTATCCTTAAAGGATATCATTGATCCTGCTTTCAGAGCATCCTGGATAGCTCAAA
AACTTAATTTGGCCAAAACACAATATATGGATGGAATTAATATAGATATAGAGCAAGAAG
TTAATTGTTTATCACCTGAATATGATGCATTAACTGCTTTAGTCAAAGAAACTACAGACT
CTTTCCATCGTGAAATTGAGGGATCACAG
gtaaaaactcatttattttttggaaacctcatattttccatatcagaatatactcatgag
ggtataactaatataatctttgttttatagtaatgcaatgggaaagagtttcagcactta
tttcctaaaaaatttttctggagcctttggtgttcttatttaaggaattttaaagcccta

Exon  3 +       6742       6815   0   Internal     74    69    Marginal
gaattacctgagagtgcttgtttaaaatatcctgagtgtattagtttgttctcacattgc
tataaagaaatacctgagactgggtaatttataaagacaataggtttaattggctcacgg
ttctgcaggctatacaggaagcataatgctgacatctgcttggcttttgggaggcctcag
GAAAACTTACAGTCATGGTGGAAGGCAAAGCGGGATCAGCACTTCAAACAGCCAGAGAAG
GAGAAAGAGAGAGG
gtggggaggtgccacacacttttaaacaatcagatcttgtgagaactctatcacgagaac
agcactggagggggaaatctgcccctgtaatccagttacctcctaccaggccctacctcc
aacattggggattacgattcaacatgagatttgggcggggacacagatccaaaccatatc

Exon  4 +       9604       9775   0   Internal    172   100   Excellent
agcaaaaaatatttcttagaatggttcaagttctatgtgtgtcaaaccctacattcatat
actgtaagcagttccttttccttgtgtagtataaggtaaaaaatatatataattttaaaa
atctgacgtaatatgcacacgtgatcatattacataaaatagtaagatttttttccacag
GTAACCTTTGATGTAGCTTGGTCTCCAAAGAACATAGACAGAAGATGCTATAATTATACT
GGAATCGCAGATGCTTGTGACTTCCTCTTTGTGATGTCTTATGATGAACAAAGTCAGATC
TGGTCAGAATGTATTGCAGCAGCCAATGCTCCCTATAATCAGACATTAACTG
gtaagactctaaacatggtcatttattaataatattaataatattctataaattaaaata
ttaagatgtttttagtatttctaagttatatgtatacgtttttcaattgtaaggcttgct
tcaaacatgtaaaaatcacttaattgaaagctttaaagtttacaaaaagttttaaagttt

Exon  5 +      11784      11881   1   Internal     98   100   Excellent
agaaagcaagatatagaatttatggttcttaagggatgttttataacatattaaacaata
ttagtgttttttataaatgtacttgtttttacaaacagattctgaacggttgcatagctt
gtatgaacacattgacatatgaagagaaacaaatatgctttttctctcctgcttgactag
GATATAATGACTACATCAAGATGAGCATTAATCCTAAGAAACTTGTAATGGGTGTTCCTT
GGTATGGTTATGATTATACCTGCCTGAATCTGTCTGAG
gtaggaacagtcatttgttacataatttttattatctattatattttttagagtctctct
gttttcattagaaatatataaactttagaatctctgaaatatagtttgagataaaaatta
tttatttttacttctatgaaagcttatgattatcatacattttcatttaataatgaaatt

Exon  6 +      12198      12359   0   Internal    162   100   Excellent
tgaaagcttatgattatcatacattttcatttaataatgaaatttattttaacctttttt
ctgtatagtcaggttttctatggtatatgttttatttctaaataatttatatatttttgg
tttggcttttaagaattgcataattgataatatataacatgagcacttttgcatttctag
GATCATGTTTGTACCATTGCAAAAGTCCCTTTCCGGGGGGCTCCTTGTAGTGACGCTGCA
GGACGTCAGGTGCCCTACAAAACGATCATGAAGCAAATAAATAGTTCTATTTCTGGAAAC
CTATGGGATAAAGATCAGCGGGCTCCTTATTATAACTATAAA
gtaagacttttcgtaagttatgagcatttattctattagtttttgtaattattttcataa
ttagatgtttgatatcaagaatttctatcagttttcttttagggcataacatgcagactg
ctatttacatgagtaaacttgtctttgaatctgtaatcaggaactttagttccctggcga

Exon  7 +      12462      12595   1   Terminal    134    67    Marginal
atcatgaagcaaataaatagttctatttctggaaacctatgggataaagatcagcgggct
ccttattataactataaagtaagacttttcgtaagttatgagcatttattctattagttt
ttgtaattattttcataattagatgtttgatatcaagaatttctatcagttttcttttag
GGCATAACATGCAGACTGCTATTTACATGAGTAAACTTGTCTTTGAATCTGTAATCAGGA
ACTTTAGTTCCCTGGCGAGCAATTGGAGTTTTGCTAATGGTGAATCTACTCTGCTTGGGC
CACTTGTCATTTAG
atgatgccataaaaatgtgcatatcacaaacaggatttctgtaacagttgacaattatgt
taggatgactgttgattttgaatgggttttgggccaaaataagttactatctctgaaagc
ctccatttcaaagtggcctacagattctgatgagacttacatagggaggaatgaggctga

Exon  8 +      17775      17789   0    Initial     15    57    Marginal
acccccagcctctggtaaccacctttttactctgtttctatgaagaaacacattctttag
gtctcagaattcaggaaacattttggtgcgcattgaaggccatttaatgccactttagaa
aaaaatctagttataactgtttccttcctcttttttttttttttgagatggagtctcact
ATGTCGCCCACGCTG
gtgtgcagtggcgcgatcttggctcactgcaagctccgcctcccgggttcacgccattct
cctgccttagcctcccaagtagctgggactacaggtgcccgccaccaagcctggctaatt
tttttgtatttttttaatagagacggggtttcactgtgttagccaggatggtctcgatct

Exon  9 +      20417      20617   0   Terminal    201    89        Good
tatagaataggaaagtgttatgccctaaaatttttatttcattgtatcctttttgaataa
ttggatttaggaaacttttttccctcttactgtactgtatacttcttttatttttccctt
tcctgtggtgctgaattgtactaaatactttaaaatctccattttaatttatttatatag
GATCCTGCTGGCCACTTTCATCAAGTATGGTATGATAACCCTCAGAGTATTTCTTTAAAG
GCAACATATATACAAAACTATCGCTTACGGGGCATTGGCATGTGGAATGCAAACTGTCTT
GACTACTCTGGAGATGCTGTAGCCAAACAGCAAACTGAAGAAATGTGGGAAGTCTTAAAG
CCAAAGCTGTTACAGAGATGA
acatcttttgtcaaaccattaagagttagaaagatgatctgtatcaacagatctagtttc
ttgcatttttattatgttgctatatacttttgttatccgtatactaaaaaaaaagaataa
ataaatgttttgattgtttgaatttgaaaaatacacacgaatgtcctcagtatccaggaa

--------------------------------------------------------------------------------