--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (47242 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (4 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      28047      28224   2   Terminal    178    73        Good
aactatgtatgtatgtataaggatagtatagtactgtataaattgtatcattccatcttt
aggtgtctttgcaagaagaatgctactttttaaatctatttttgttacctgtgttagtag
ggctctttagcaaaagttctgagtaaagttattttgaaatgtttgtttccttatgcatag
ATTCGATGTTACAGAGTCCCAGATCATAATTATAATATGCCAGCTTCTCACAGGAACCCT
GGGGCCTTGGTTCTGGAACTTCACGGTAACTGCTAGAATATTCATGCTATCTGATGTACA
ATGGTGTGAATTCAATAAAGACAGCACCTTTGTCATGCACAGAATAATTAAAACATGA
aaaatcaaaagtcttcctgttggtatgtcacaaacaggttattagaaaacataattttaa
tatattagggcaataaaaatccaccctattaaataaaatttttaaaaagtggtatttctg
gtgatttgatgctaaagtcaattctcctgtttgcctattgtgcctattatttttattcta

Exon  2 +      39219      39291   0    Initial     73    59    Marginal
aggaacaaatactacatattgagctctcacatttttgtgtgccaaatggagaaaagatat
ttacttagggttcaggtatgaaatttacatctcttctgagattgaggccataaaatggaa
attgccttccaaatcctcattaagttagaaggcttttactgacatttagaaagcaagttt
ATGGTCAGAACAAATAAAAACAGTGCAGATGTCTTCATAAGGCTGATTCCAGAAGATCAG
CTGTTTTGTAAAG
gtaagtgatttgcatctattacatatggattacccattctttcccaaattttttccccaa
agagatgaatttttaccaaagattatagttattgttgttgttgtggttttcctttttttt
ttttccaaaggaaagcagttgtcttcatgcataaaagtcagtgcttgttttatacattgc

Exon  3 +      43740      43898   0   Internal    159    81        Good
atgaatttatgctgctacttttcattagctcttctagtttgtgatttatagaaattgctg
cctatcaggcaccatgaggttcctgaaagtttgagttgaactgtgaactgttctgcagca
gatccatgtagtatctgatgagtactgaatactattaactcttctcttcactctgtacag
GGAACAAGTGTCCTTTCTCCTTTTCTCCATATTGGATCAGTGATTACATTAGCTGCAATG
ATCTACAAGAAATCTGCAGTTCAGCTTTTTGAAAAGCATCCCTGTCTTTATATACTGACA
TTTGGTTTTGTGTCTGCTAAAATCACTAATAAGCTTGTG
gtaagcacctgagtttttatttgctgtgtttttcactttcatcttattttggatttatgg
ctatagttctcattctgtagcttcataaatggtcctagagtttgccctcttctaatcaga
atctcttgatatcaacatgggaactatttttactcttttgtgaagctacaatttgaagtt

Exon  4 +      44403      44528   0   Internal    126    89        Good
acatgatacatccctttctttctcagacgcatttcatattgttgggtttttagttttggg
aattcaacagctattcctaaataattattggaagttgatatctgagcacaatatgattta
ctgtgtagttcacaattgtcctcttatgaaaatgcctacgttattctgttttattcatag
GTTGCACACATGACGAAAAGTGAAATGCATTTGCATGACACAGCATTCATAGGTCCGGCA
CTTTTGTTTCTGGACCAGTATTTTAACAGCTTTATTGATGAATATATTGTACTTTGGATT
GCCCTG
gtaagtattgtactaagtcttatttcatggtttgagggtttgaaggttgcttgttttctt
attttgatgacccagtcatgaaagatcgttcatataattgtaatgatttggaatgtcaga
aatccacataaatggggctgtgtgagagttctatggctttatatttgagccttttatttt

--------------------------------------------------------------------------------