--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (63678 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (28 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3506       3808   0    Initial    303    77        Good
tgcctgagctagaagaatccgctttgtttttttttttttttaaattttaaatctttaatt
tctgttttcacgtattttcttcttgcttccaaaaggaaaggagtgcgtagctctgttgcc
tgtacatcgtccacagcccctgggttggagcggggtcccctgggccgcccgggggtccac
ATGCAGCCCCTGGGGGGCCGGCGCGGGGTGAGGTCCGGGGGCTGCCTTATTGCTGAGGTC
TGGCCGGTTGGTGCCGCCGCTAGGCGAGCTGGCTGGCAGCTCCTGGGAGATGAAGCGACG
CAGGCCCTCCAGGTACTGGCTGTAGAGCTCGATGTCGTTGTGCCTGGTGCCCTCCACCCA
CAGCGGCTCCACCGCCTTGGGGCAGCGCTCGTAGAGCGCCAGCCCGTGCGAGAAGTCGAT
CACCTCGTCCTCCGTGCCGTGGATGATGAGCACGGGCGACGTGATCTTGGACACCTTCTC
GAT
gttagggaaggcgtcgaagcagtaggtcttcttggtgtcggggaaggcgacgcgcatgcc
cgaggtgagcggcgaatgcagcaccaccgcggcacactcgtagcgcgaggccaggtccac
ggtgggcaccgtgccgatgctctgcccgtacaggatgatgctgtccgggctgatgccgta

Exon  2 +       3962       4279   2   Internal    318    54    Marginal
cgacgtgatcttggacaccttctcgatgttagggaaggcgtcgaagcagtaggtcttctt
ggtgtcggggaaggcgacgcgcatgcccgaggtgagcggcgaatgcagcaccaccgcggc
acactcgtagcgcgaggccaggtccacggtgggcaccgtgccgatgctctgcccgtacag
GATGATGCTGTCCGGGCTGATGCCGTACCTGGAGGCGCCGGAGCAGGGTCAGCCGCGGCC
TCCGACGCGCGCGCACCCTTCCCGCCAGCGGGCGTCCCCGGGCCCAGCTCCGGATGCGAC
CCTCCAGTCTCCCCACTCAGCCAAGTCAGTGGGTCAGGCCCAGGCTCCACACCAGTCCCG
AGGGCCACCCCCAGCCCTCAACACCGCGGCGGTGGGCGAAGCCAGCGGCCCCACCCCGTT
CCCTGGCGCTGCCGTTCCCTGGCGTTTCCTAGCTAGGATCTGTAGGGATCCCGCCTACGG
AGTGGCCCTGGGGCGGAG
gtaggggaggccctggcgcctctcctcctgatcacccctaggtgcacactgggaactgtg
tgccccccacatcctgaatgcttcacgccttcctgcccgggttagaaagccgttcctggt
gcactggccaggacagcggacactcttcctccctgcagcccttgcccacccccttggcca

Exon  3 +       6235       6563   0   Internal    329    60    Marginal
cacctgcacacccaagctcgcctgtccggctctctggccctgtgcatccactgtggctcc
cctcctgcagagccgcccaccttcctcccagggaagcccgccccccggcccccggcctgg
tcccctcttgggtgtgcccaggctgagctgcccccagggttgccctcacctggtgcgcag
GGCCTGCCAGGCGGCGTCGATGTCGGCATAGAGGTTCCTCTCGGAAGGCCTACCCGAGCT
GGCACCGTAGCCGGAGTAGTCGTAGGAGAAGATGTTGCAATGGAGGCGGGAGCCCAGGCC
AATGTAGAAGCTGCTCATCTGGCCCAGGTCCACGGCATTGCTGTGCGAGAAGAGGACCGT
GTACCTGGCACCAGTCACGCAGCGAACATACATGCAGGAGACGCGGTTGCGGCGGGCGCT
CTTGGTGGGGAAGACCTCAATGGTGTCCAGCTCGCGCTGGCTGTACTGGAAGTCGGCGCG
CTCCGTCAGGTGCAGCTTCCAGCGCCCGG
gtgcgcccgaggaggcccgcagggtccccaagggggcggccccggccccaccaggccccg
gctcgggctcagtcaccaaggaataggtggcctccggcggcaggaaggcgagcttggcag
cgatgcggccggggcagggcgggcagcagaagaggcagcagagctcactcagcgacagcc

Exon  4 +      11665      11853   0     Single    189    45    Marginal
gataggtattatactttgttatcttttgaaatgtggtcttgaaacttgatttttaggggt
ggttagatagattcattaatttctgagactttgtttccttttactgtggtaagaccaaca
gtctggttattcttttcagtttatttacaaatgttggagtaataaagaaggcagaacaaa
ATGAGCTGGGCTTTGGAAGAATGGAAAGAAGGGCTGCCTACAAGAGCTCTTCAGAAAATT
CAAGAGCTTGAAGGACAGCTTGACAAACTGAAGAAGGAAAAGCAGCAAAGGCAGTTTCAG
CTTGACAGTCTCGAGGCTGCGCTGCAGAAGCAAAAACAGAAGGTACCCCTGAAGCTCTGG
TATTTGTAG
ctgttcactcattattgacagagaagtgctggtatttaaaactgttcactcatttttgga
ttaattatttcatcttctttacatttagagaaaaatgattttgctgtcttcaggtggtaa
ttcctctcccctcccccacccccaccccaggccccaatccccttctttttttttttttga

Exon  5 +      12742      12938   0   Internal    197   100   Excellent
tcaaagaagtttcctatctattggcttcaaagtgtgatcatctaaaatttctgtgttcat
atggcttattgcagctgtatctcaggaatttagtagtcaatgttagactcaggtttacca
ataatacttggtaaattcacaaaataagggagttattgtcttctgaacaattctcattag
GTTGAAAATGAAAAAACCGAGGGTACAAACCTGAAAAGGGAGAATCAAAGATTGATGGAA
ATATGTGAAAGTCTGGAGAAAACTAAGCAGAAGATTTCTCATGAACTTCAAGTCAAGGAG
TCACAAGTGAATTTCCAGGAAGGACAACTGAATTCAGGCAAAAAACAAATAGAAAAACTG
GAACAGGAACTTAAAAG
gtaatattttgggatggtatttatagggatgatatttgtatgtattaatcagatgcgttt
gtcttttcctttaacaatataattattatactttgcaattttttttcctggtagaataag
taatgattcggtctctgtaccgtaacttgaaagagtggaagattaaaaacaaacaaacag

Exon  6 +      16483      16541   1   Terminal     59    61    Marginal
gtttatgtctggcacataagttagaccttatgaaatgcctgttggataaatgaaatggtt
aagaattcttagtggatgggtttctttgtaagtttattactctctgggaatgtaaggcat
tgatattctgtagcctttgctctaactgatttgtctgcctcttgggtccttttctaacag
GTGTAAATCTGAGCTTGAAAGAAGCCAACAAGCTGCGCAGTCTGCAGATGTCTCTCTGA
atccatgcaatacaccacaaaaaatttttacaactccactaacaccaagtcaatattata
gtggtaatgcattttcttccttggtatagacagctttttgtttagcttgagattttaatt
ctgcaaaataaatgaattaattcaactttgaattaaacttttaatgtatatgtttaaaaa

Exon  7 +      17039      17130   1   Internal     92    91   Excellent
tatgtttttatgtgttttgatatttgagtaatttgatcaatagtttgatctatttcccta
accaaaatgttgtttctactaagatactcatttctagactatcaaaatcgttgttgatct
gtgaattccttcatggaatcaatgactgaaagaaaactgtatttgattgtctgtttctag
GTTCCAAGTATGAAGATCTAAAAGAAAAATATAATAAAGAGGTTGAAGAACGAAAAAGAT
TAGAGGCAGAGGTTAAAGCCTTGCAGGCTAAA
gtaagttaattatgggccctataatagagtatgcagttatagaatactttgatatagaat
agaacaaggttagagaaaaatctgttttacatagagctggcctttttgtgtgtgtgtgtg
ctgagaaaaggttttgggctcagtggaggtgattattttttagttttaaaaatagggtgg

Exon  8 +      18565      18667   0   Internal    103    62    Marginal
ttagaacattccatcactgggtattagacttatggtttacttgacttgatgaatgttctt
tgttggtatgcagtgcaactgttaacttcttgggattatggctttatattctatctgaaa
ataaatagccttgagtatataagatctttaaaggcctctaaagagattctgtttctacag
AAAGCAAGCCAGACTCTTCCACAAGCCACCATGAATCACCGCGACATTGCCCGGCATCAG
GCTTCATCATCTGTGTTCTCATGGCAGCAAGAGAAGACCCCAA
gtcatctttcatctaattctcaaagaactccaattaggagagatttctctgcatcttact
tttctggggaacaagaggtgactccaagtcgatcaactttgcaaatagggaaaagagatg
ctaatagcagtttctttgacaattctagcagtcctcatcttttggatcaattaaaagcgc

Exon  9 +      20045      20191   0    Initial    147    49    Marginal
ctgtatttagtgtaaatatttgtttcgtcaaagatttcagaaaagaataaaacaaatgat
aagttatgaacattttgggaaagatatatatgaattggagtgtgatttttgtttgtggtt
caagagctaagaaacaagattaatgagttggaactacgcctgcaaggacatgaaaaagaa
ATGAAAGGCCAAGTGAATAAGTTTCAAGAACTCCAACTCCAACTGGAGAAAGCAAAAGTG
GAATTAATTGAAAAAGAGAAAGTTTTGAACAAATGTAGGGATGAACTAGTGAGAACAACA
GCACAATACGACCAGGCGTCAACCAAG
gtacttgacttttcgtgaattactggagaaatcttcatcttttcatacaattatttagaa
agagtattttatacataagtttatgaaatgtcagtaatgttctttgttaatatatattag
gtactcttgatgcaactgaactagaaagctgttttaagttgggcagatccgggatcaagc

Exon 10 +      20312      20437   1   Internal    126    53    Marginal
aacaaatgtagggatgaactagtgagaacaacagcacaatacgaccaggcgtcaaccaag
gtacttgacttttcgtgaattactggagaaatcttcatcttttcatacaattatttagaa
agagtattttatacataagtttatgaaatgtcagtaatgttctttgttaatatatattag
GTACTCTTGATGCAACTGAACTAGAAAGCTGTTTTAAGTTGGGCAGATCCGGGATCAAGC
CTGGTGCCGTACTTTCCCAGCTGAGTGACGTTGGGCAAGTCACTGATCTCTTTTATGTTG
CAGGGG
gtaatagagaataaagaaaatgtatatatagcatctagcatgatgtgtgccacattaaaa
taggcacttaatggcactttaaaggagttttaggacatttgataggatttaattaatctg
ctcttgggatcgtatatatagttggtccattgtacccatgagttctgcattcatggattc

Exon 11 +      25903      25977   0    Initial     75    75        Good
gtaactgaaataaaattatgctatgtttatgctggttccagatctaacattagacttatc
tattaaatgaaatggaattactgtaacaaaaatcaataccgtgttcttaagtgaacatat
gctgtttgtagagtgtcttttccaagtatttacaagttgtgagatacaaggcttgaattc
ATGGAGAAACAGAGTGTTGAGCTGGCAGCAGACCTGGAGTTCAGCACCCACAGTTCACAG
ATAAAAAGGTCCGGA
gtgagtgcccagggtcatgttgtgctacatattttcaaggacttgagctctgggcactgt
tttagagtattatggagcattcatgacacctagtggtcatatactcttatatgaattagg
tatcactgataatagaatgttgtttaaaattttttaaataaaatgtaagtaccttctaaa

Exon 12 +      26956      27081   0   Internal    126    82        Good
ttcatggcacaaattaggaagtatttatttaagtgggctaatgctttacatccttgctaa
tagttcctaaacataaattgtgtgctaaaacaattatagcagtttttctaaaacacaaaa
tatttgttcatttatgtgagtaatatttattttgtcttgaacatttttattcattattag
TATACTGCATTGGAACAAAAACTGAAAAAATTGACGGAAGATTTGAGTTGTCAGCGACAA
AATGCAGAAAGTGCCAGATGTTCTCTGGAACAGAAAATTAAGGAAAAAGAAAAGGAGTTT
CAAGAG
gtaaggtaaatggattcatgaggtgtttgtctgaaaggctttttatgggcttttcatagt
ttgatcacttggaaaggggagttgttatcacaatttgggaaattctcttagaggagaaat
gctttgtgagctaaaggtcatcttattttctttcacatcttcacttttgcgcttttttta

Exon 13 +      28402      28572   0   Internal    171   100   Excellent
gataagagtccttcccctttccctcagagacctggatttgatgcctgagggcagcatgga
gcaccaaggctgactatgttcatcgttaagtggacagttggctcagctccctgctgtctc
ctgtgctctctgtgcagtcgcctgttaggatgctcatgcctcaccctggagtctccctag
CGAACCATCATCAGGCTGATGCACCTGCCCTTTGTTTTTCAGGAGCTCTCCCGTCAACAG
CGTTCTTTCCAAACACTGGACCAGGAGTGCATCCAGATGAAGGCCAGACTCACCCAGGAG
TTACAGCAAGCCAAGAATATGCACAACGTCCTGCAGGCTGAACTGGATAAA
gtaggggccgtgtctctctctctctccttaatcatcccctcttgttccttgtacttgtta
cttctctaccataactgacatatgatactttcaaagaaaaagcgctccaccttcactttc
cctatcaaagtggagaatgtacagaaccattctggctctaggtttcctcatctagagaaa

Exon 14 +      30390      30547   0   Internal    158    99   Excellent
cgtcgcaaggtcacattatggtattttaagacatatttagctgtgacgtatactgtatct
cagccaaaatagatggcatccattttgatattccatgaccattttattgtttaagaatac
atgattaatgaaaaagtaaagaacatgaaaatgaaacttggtctctttttctttttgtag
CTCACATCAGTAAAGCAACAGCTAGAAAACAATTTGGAAGAGTTTAAGCAAAAGTTGTGC
AGAGCTGAACAGGCGTTCCAGGCGAGTCAGATCAAGGAGAATGAGCTGAGGAGAAGCATG
GAGGTAAGGGAGGAGGATGCCGAATTTTCTCCACTTAT
gtaagaaccaagtgcaaggggaaaagaatattcctattccatttgtcagttgcttgtcat
gactgtgtgcctttttcttttctattcaccagaagtaagtattacagaattttctgtata
taacccatgacagaatatgattgcttatttttctactctctattctgtatataattacta

Exon 15 +      31531      31918   2   Terminal    388    56    Marginal
aagaatggtagaaatttcttctccatcaaaccccacaggaaagaatgtttttctgtttat
tctttaaatgttctatgatcactttttaggctgtaaagattaagaaaactttgtccataa
agaacagttatttgttcaggtgaggaaagtctaaatgtatttatccccaccgctttgcag
AGTGTATCATGATGGTAAAATCAGAACATCTGTCAGTAGCAGACAGGTGATTGTTAAATC
AGCTAACCCCAAAGGGGCAATACTGCTGGAGATAGGGGGCTGCAGCTCCAGCCACAAAGT
GGAAGAAAACTTCAAATCAGATGATAGTTTCATCAGCAAACGTTTTCAAATGGAAGTGTT
TGTTTCAGCAAAACAAATGTTTGCCTTTTGGCCAGTGGGGACCAACCAACAGATGCTTCT
GCTAACATTTCCACAGGCAGACTGGCATCGAACTCTTCCCTCTGTGAGCTTCCCTTTCAG
CCAGGAACTCTCCCGCGACTCCACTGGCTGCCTGGTGGAAACATTTTGTAAAAGCAATCA
TCTGGTTAAGAGAGTCCAAACACTTTAA
aaactgcttgcttggccaagtcgcagtagtgggctggacattgtcttgcaggtgtttctg
aagacttgttcatccccacgaggtctggtccgtgagctgtagcgctgtcctcagttaatc
ccagcctgtactgaggtgcatgcatcacatttcactggtatatcattgatgtctgtgtca

Exon 16 +      35779      35911   0    Initial    133    95   Excellent
ttcataacattatttaagtaagaatgtctgacttcattaggtactcaaacggggaaattg
tgattctttccctagtgagatacacaaacagttctgctagggacctttattaaggcagaa
gtcataacttacttgagcattcgttttggctataaccaattaaaatgtgtgttttaggaa
ATGAAGAAGGAAAACAACCTCCTTAAGAGTCACTCTGAGCAAAAGGCCAGAGAAGTCTGC
CACCTGGAGGCAGAACTCAAGAACATCAAACAGTGTTTAAATCAGAGCCAGAATTTTGCA
GAAGAAATGAAAG
gtaagtaaacttagtattttagagttacctttctaagctgctattcccgtgagaggggat
ggatggcattaacatattagagaaactctttggattttttttcatatattccctcaaaaa
gatgtgcgcagttgatgtggaagagttttccctcttctagtttttagtttccagagtgag

Exon 17 +      37831      41238   1   Internal   3408    94   Excellent
aagataattaccaagtgatccactttctaggaggtacccaggcaataatgccagtttttc
cagggcttgagtagttgttagtttgtttggattttgccagggggcggggggaggggttag
cgtttctgtagaataaacatttattacaaacattgacgacttttatttatttttaaatag
CGAAGAATACCTCTCAGGAAACCATGTTAAGAGATCTTCAAGAAAAAATAAATCAGCAAG
AAAACTCCTTGACTTTAGAAAAACTGAAGCTTGCTGTGGCTGATCTGGAAAAGCAGCGAG
ATTGTTCTCAAGACCTTTTGAAGAAAAGAGAACATCACATTGAACAACTTAATGATAAGT
TAAGCAAGACAGAGAAAGAGTCCAAAGCCTTGCTGAGTGCTTTAGAGTTAAAAAAGAAAG
AATATGAAGAATTGAAAGAAGAGAAAACTCTGTTTTCTTGTTGGAAAAGTGAAAACGAAA
AACTTTTAACTCAGATGGAATCAGAAAAGGAAAACTTGCAGAGTAAAATTAATCACTTGG
AAACTTGTCTGAAGACACAGCAAATAAAAAGTCATGAATACAACGAGAGAGTAAGAACGC
TGGAGATGGACAGAGAAAACCTAAGTGTCGAGATCAGAAACCTTCACAACGTGTTAGACA
GTAAGTCAGTGGAGGTAGAGACCCAGAAACTAGCTTATATGGAGCTACAGCAGAAAGCTG
AGTTCTCAGATCAGAAACATCAGAAGGAAATAGAAAATATGTGTTTGAAGACTTCTCAGC
TTACTGGGCAAGTTGAAGATCTAGAACACAAGCTTCAGTTACTGTCAAATGAAATAATGG
ACAAAGACCGGTGTTACCAAGACTTGCATGCCGAATATGAGAGCCTCAGGGATCTGCTAA
AATCCAAAGATGCTTCTCTGGTGACAAATGAAGATCATCAGAGAAGTCTTTTGGCTTTTG
ATCAGCAGCCTGCCATGCATCATTCCTTTGCAAATATAATTGGAGAACAAGGAAGCATGC
CTTCAGAGAGGAGTGAATGTCGTTTAGAAGCAGACCAAAGTCCGAAAAATTCTGCCATCC
TACAAAATAGAGTTGATTCACTTGAATTTTCATTAGAGTCTCAAAAACAGATGAACTCAG
ACCTGCAAAAGCAGTGTGAAGAGTTGGTGCAAATCAAAGGAGAAATAGAAGAAAATCTCA
TGAAAGCAGAACAGATGCATCAAAGTTTTGTGGCTGAAACAAGTCAGCGCATTAGTAAGT
TACAGGAAGACACTTCTGCTCACCAGAATGTTGTTGCTGAAACCTTAAGTGCCCTTGAGA
ACAAGGAAAAAGAGCTGCAACTTTTAAATGATAAGGTAGAAACTGAGCAGGCAGAGATTC
AAGAATTAAAAAAGAGCAACCATCTACTTGAAGACTCTCTAAAGGAGCTACAACTTTTAT
CCGAAACCCTAAGCTTGGAGAAGAAAGAAATGAGTTCCATCATTTCTCTAAATAAAAGGG
AAATTGAAGAGCTGACCCAAGAGAATGGGACTCTTAAGGAAATTAATGCATCCTTAAATC
AAGAGAAGATGAACTTAATCCAGAAAAGTGAGAGTTTTGCAAACTATATAGATGAAAGGG
AGAAAAGCATTTCAGAGTTATCTGATCAGTACAAGCAAGAAAAACTTATTTTACTACAAA
GATGTGAAGAAACCGGAAATGCATATGAGGATCTTAGTCAAAAATACAAAGCAGCACAGG
AAAAGAATTCTAAATTAGAATGCTTGCTAAATGAATGCACTAGTCTTTGTGAAAATAGGA
AAAATGAGTTGGAACAGCTAAAGGAAGCATTTGCAAAGGAACACCAAGAATTCTTAACAA
AATTAGCATTTGCTGAAGAAAGAAATCAGAATCTGATGCTAGAGTTGGAGACAGTGCAGC
AAGCTCTGAGATCTGAGATGACAGATAACCAAAACAATTCTAAGAGCGAGGCTGGTGGTT
TAAAGCAAGAAATCATGACTTTAAAGGAAGAACAAAACAAAATGCAAAAGGAAGTTAATG
ACTTATTACAAGAGAATGAACAGCTGATGAAGGTAATGAAGACTAAACATGAATGTCAAA
ATCTAGAATCAGAACCAATTAGGAACTCTGTGAAAGAAAGAGAGAGTGAGAGAAATCAAT
GTAATTTTAAACCTCAGATGGATCTTGAAGTTAAAGAAATTTCTCTAGATAGTTATAATG
CGCAGTTGGTGCAATTAGAAGCTATGCTAAGAAATAAGGAATTAAAACTTCAGGAAAGTG
AGAAGGAGAAGGAGTGCCTGCAGCATGAATTACAGACAATTAGAGGAGATCTTGAAACCA
GCAATTTGCAAGACATGCAGTCACAAGAAATTAGTGGCCTTAAAGACTGTGAAATAGATG
CGGAAGAAAAGTATATTTCAGGGCCTCATGAGTTGTCAACAAGTCAAAACGACAATGCAC
ACCTTCAGTGCTCTCTGCAAACAACAATGAACAAGCTGAATGAGCTAGAGAAAATATGTG
AAATACTGCAGGCTGAAAAGTATGAACTCGTAACTGAGCTGAATGATTCAAGGTCAGAAT
GTATCACAGCAACTAGGAAAATGGCAGAAGAGGTAGGGAAACTACTAAATGAAGTTAAAA
TATTAAATGATGACAGTGGTCTTCTCCATGGTGAGTTAGTGGAAGACATACCAGGAGGTG
AATTTGGTGAACAACCAAATGAACAGCACCCTGTGTCTTTGGCTCCATTGGACGAGAGTA
ATTCCTACGAGCACTTGACATTGTCAGACAAAGAAGTTCAAATGCACTTTGCCGAATTGC
AAGAGAAATTCTTATCTTTACAAAGTGAACACAAAATTTTACATGATCAGCACTGTCAGA
TGAGCTCTAAAATGTCAGAGCTGCAGACCTATGTTGACTCATTAAAGGCCGAAAATTTGG
TCTTGTCAACGAATCTGAGAAACTTTCAAGGTGACTTGGTGAAGGAGATGCAGCTGGGCT
TGGAGGAGGGGCTCGTTCCATCCCTGTCATCCTCTTGTGTGCCTGACAGCTCTAGTCTTA
GCAGTTTGGGAGACTCCTCCTTTTACAGAGCTCTTTTAGAACAGACAGGAGATATGTCTC
TTTTGAGTAATTTAGAAGGGGCTGTTTCAGCAAACCAGTGCAGTGTAGATGAAGTATTTT
GCAGCAGTCTGCAGGAGGAGAATCTGACCAGGAAAGAAACCCCTTCGGCCCCAGCGAAGG
GTGTTGAAGAGCTTGAGTCCCTCTGTGAGGTGTACCGGCAGTCCCTCGAGAAGCTAGAAG
AGAAAATGGAAAGTCAAGGGATTATGAAAAATAAGGAAATTCAAGAGCTCGAGCAGTTAT
TAAGTTCTGAAAGGCAAGAGCTTGACTGCCTTAGGAAGCAGTATTTGTCAGAAAATGAAC
AGTGGCAACAGAAGCTGACAAGCGTGACTCTGGAGATGGAGTCCAAGTTGGCGGCAGAAA
AGAAACAGACGGAACAACTGTCACTTGAGCTGGAAGTAGCACGACTCCAGCTACAAGGTC
TGGACTTAAGTTCTCGGTCTTTGCTTGGCATCGACACAGAAGATGTAA
gtacctgggatttaaatgccatttctcggtttacatgactagtggacactcagtaaatgt
ttgtctaattgaaatgtacattaaacctaagttaaaatatttttagggttcaaggaaata
aaatacaccaaaatattttcaaaacaaaccagaacttgaggaaaatgagtaaacgttatt

Exon 18 +      41894      41967   1   Internal     74    53    Marginal
aatttactgtggtacaaaaatatgatttggtataagtcatttaaaagggcttttaaaaaa
ttgaatacatatttgtttaattgcttgtaactttgtcctttctagcctgctagcttaatt
aataatgctatatagtgtatgcatgtcacttgatttcctctgtctatctctgtgaggtag
AGAAGGCAGGTCATGGTGAGGTGATGGCAGGTGTAGGTGCAACAGCAGATCCCCAGTTTA
CAGATGAGAGGAAA
gtgaggctcaaatatgtaatttatccaataatgtacagtaagtgctggattggggattaa
gtccttggactgggaatctggttatgaaactttactgccttattaaagagtatcataaat
gctgaaggtggaagctgagcattttgttagcctcttatttaataattacaaagagatttc

Exon 19 +      42467      45346   0   Terminal   2880    90   Excellent
acgtataagtatgttgaacatttgaatgaagagagaaagatgtagtgggaaattcaccac
tttaagagatgtgtttagcagaggccacgcatcagtttctaaaaagtaataactaaatct
attctattttgattctttttgaaaaataaaatgcatgcttgttatgtattataattacag
GCTATTCAAGGCCGAAATGAGAGCTGTGACATATCAAAAGAACATACTTCAGAAACTACA
GAAAGAACACCAAAGCATGATGTTCATCAGATTTGTGATAAAGATGCTCAGCAGGACCTC
AATCTAGACATTGAGAAAATAACTGAGACTGGTGCAGTGAAACCCACAGGAGAGTGCTCT
GGGGAACAGTCCCCAGATACCAATTATGAGCCTCCAGGGGAAGATAAAACCCAGGGCTCT
TCAGAATGCATTTCTGAATTGTCATTTTCTGGTCCTAATGCTTTGGTACCTATGGATTTC
CTGGGGAATCAGGAAGATATCCATAATCTTCAACTGCGGGTAAAAGAGACATCAAATGAG
AATTTGAGATTACTTCATGTGATAGAGGACCGTGACAGAAAAGTTGAAAGTTTGCTAAAT
GAAATGAAAGAATTAGACTCAAAACTCCATTTACAGGAGGTACAACTAATGACCAAAATT
GAAGCATGCATAGAATTGGAAAAAATAGTTGGGGAACTTAAGAAAGAAAACTCAGATTTA
AGTGAAAAATTGGAATATTTTTCTTGTGATCACCAGGAGTTACTCCAGAGAGTAGAAACT
TCTGAAGGCCTCAATTCTGATTTAGAAATGCATGCAGATAAATCATCACGTGAAGATATT
GGAGATAATGTGGCCAAGGTGAATGACAGCTGGAAGGAGAGATTTCTTGATGTGGAAAAT
GAGCTGAGTAGGATCAGATCGGAGAAAGCTAGCATTGAGCATGAAGCCCTCTACCTGGAG
GCTGACTTAGAGGTAGTTCAAACAGAGAAGCTATGTTTAGAAAAAGACAATGAAAATAAG
CAGAAGGTTATTGTCTGCCTTGAAGAAGAACTCTCAGTGGTCACAAGTGAGAGAAACCAG
CTTCGTGGAGAATTAGATACTATGTCAAAAAAAACCACGGCACTGGATCAGTTGTCTGAA
AAAATGAAGGAGAAAACACAAGAGCTTGAGTCTCATCAAAGTGAGTGTCTCCATTGCATT
CAGGTGGCAGAGGCAGAGGTGAAGGAAAAGACGGAACTCCTTCAGACTTTGTCCTCTGAT
GTGAGTGAGCTGTTAAAAGACAAAACTCATCTCCAGGAAAAGCTGCAGAGTTTGGAAAAG
GACTCACAGGCACTGTCTTTGACAAAATGTGAGCTGGAAAACCAAATTGCACAACTGAAT
AAAGAGAAAGAATTGCTTGTCAAGGAATCTGAAAGCCTGCAGGCCAGACTGAGTGAATCA
GATTATGAAAAGCTGAATGTCTCCAAGGCCTTGGAGGCCGCACTGGTGGAGAAAGGTGAG
TTCGCATTGAGGCTGAGCTCAACACAGGAGGAAGTGCATCAGCTGAGAAGAGGCATCGAG
AAACTGAGAGTTCGCATTGAGGCCGATGAAAAGAAGCAGCTGCACATCGCAGAGAAACTG
AAAGAACGCGAGCGGGAGAATGATTCACTTAAGGATAAAGTTGAGAACCTTGAAAGGGAA
TTGCAGATGTCAGAAGAAAACCAGGAGCTAGTGATTCTTGATGCCGAGAATTCCAAAGCA
GAAGTAGAGACTCTAAAAACACAAATAGAAGAGATGGCCAGAAGCCTGAAAGTTTTTGAA
TTAGACCTTGTCACGTTAAGGTCTGAAAAAGAAAATCTGACAAAACAAATACAAGAAAAA
CAAGGTCAGTTGTCAGAACTAGACAAGTTACTCTCTTCATTTAAAAGTCTGTTAGAAGAA
AAGGAGCAAGCAGAGATACAGATCAAAGAAGAATCTAAAACTGCAGTGGAGATGCTTCAG
AATCAGTTAAAGGAGCTAAATGAGGCAGTAGCAGCCTTGTGTGGTGACCAAGAAATTATG
AAGGCCACAGAACAGAGTCTAGACCCACCAATAGAGGAAGAGCATCAGCTGAGAAATAGC
ATTGAAAAGCTGAGAGCCCGCCTAGAAGCTGATGAAAAGAAGCAGCTCTGTGTCTTACAA
CAACTGAAGGAAAGTGAGCATCATGCAGATTTACTTAAGGGTAGAGTGGAGAACCTTGAA
AGAGAGCTAGAGATAGCCAGGACAAACCAAGAGCATGCAGCTCTTGAGGCAGAGAATTCC
AAAGGAGAGGTAGAGACCCTAAAAGCAAAAATAGAAGGGATGACCCAAAGTCTGAGAGGT
CTGGAATTAGATGTTGTTACTATAAGGTCAGAAAAAGAAAATCTGACAAATGAATTACAA
AAAGAGCAAGAGCGAATATCTGAATTAGAAATAATAAATTCATCATTTGAAAATATTTTG
CAAGAAAAAGAGCAAGAGAAAGTACAGATGAAAGAAAAATCAAGCACTGCCATGGAGATG
CTTCAAACACAATTAAAAGAGCTCAATGAGAGAGTGGCAGCCCTGCATAATGACCAAGAA
GCCTGTAAGGCCAAAGAGCAGAATCTTAGTAGTCAAGTAGAGTGTCTTGAACTTGAGAAG
GCTCAGTTGCTACAAGGCCTTGATGAGGCCAAAAATAATTATATTGTTTTGCAATCTTCA
GTGAATGGCCTCATTCAAGAAGTAGAAGATGGCAAGCAGAAACTGGAGAAGAAGGATGAA
GAAATCAGTAGACTGAAAAATCAAATTCAAGACCAAGAGCAGCTTGTCTCTAAACTGTCC
CAGGTGGAAGGAGAGCACCAACTTTGGAAGGAGCAAAACTTAGAACTGAGAAATCTGACA
GTGGAATTGGAGCAGAAGATCCAAGTGCTACAATCCAAAAATGCCTCTTTGCAGGACACA
TTAGAAGTGCTGCAGAGTTCTTACAAGAATCTAGAGAATGAGCTTGAATTGACAAAAATG
GACAAAATGTCCTTTGTTGAAAAAGTAAGTGGCTATATCTGTTTATGTTTAAATATGTAG

tcatgaggcaggaaaccatattttcttctagacactgtgaattgtatttacttctagacc
gtgtctgctatattggaccaaactttgtaaaggctttatgtttactgggtcttgaattgc
agaaacactgagttggctctggcagtagtcactattctggctgattctttgggacatgtt

Exon 20 +      46594      46737   0    Initial    144    96   Excellent
tagtaggttttgagaatgttgagttgagtggattagtaaaggcgggattagccagcttcc
attttatgattgaaggctaaaataaatggcatgaatatgttgtatcagagtggtcgatct
gatcaaaacagaccaccaaaaagcagattctaatgaaagatgaaatttcaggtaaacaaa
ATGACTGCAAAGGAAACTGAGCTGCAGAGGGAAATGCATGAGATGGCACAGAAAACAGCA
GAGCTGCAAGAAGAACTCAGTGGAGAGAAAAATAGGCTAGCTGGAGAGTTGCAGTTACTG
TTGGAAGAAATAAAGAGCAGCAAA
gtaagtttctttgtgacaagtgttattatgatctgttaattcattgtgcacactctcctt
attggttcctgtaagaccttctgttgtttacctaacttatttttagctcttgaaaaaaat
aaccctgtgcttatgtcataatctgatttatagtaatctctaccatccagcactatcagg

Exon 21 +      49103      49279   0    Initial    177    42    Marginal
tagaagaatgtgcctttagtttgcagcatggaggttgctgatgccatgaaaagctttttt
aggaagagctgggacgaattgattggagcaggttaaagaattggagatgaggaagtagac
accacacatacagaaacacatacagagacagctactcagggtcaggcacggagaagacaa
ATGCTTCCAGGGTTGGAGTTTGGCCAGTTCTTCACAGTGAAGGGATGGGGCAAAAGATTG
GAGGGCATTTGGAAGGAAATTCTTATAGTGACAGAACTGGAGTCTAAGCTGGTCAAGGAA
GAAAATGCAAGTCCGGAGGGGATTTGGTGTGAAGATGGTAGTGGTTCTGTTGATGAG
gtcaggaattattgcaatggaagtactttaataaacaaggttggaagcataggaaggtgt
ggtcccagagtggtttaattgaattcaaggtttcagagtttctgtggtctctggatatga
ccttgcgaggtggttgggctggagcagaggaaagtgttattggaggtgaagtcacaatta

Exon 22 +      49620      49796   0   Internal    177   100   Excellent
tggaggtgaagtcacaattaaaagtgaatacattgctaaggattatagcactattctgta
cagattttatcttgcccataaatattttttttctacacagtacacattatttcctaaaaa
tatttccaggttcttaattatgaggaggtgctattatgattttattatttttctgtttag
GATCAATTGAAGGAGCTCACACTAGAAAATAGTGAATTGAAGAAGAGCCTAGATTGCATG
CACAAAGACCAGGTGGAAAAGGAAGGGAAAGTGAGAGAGGAAATAGCTGAATATCAGCTA
CGGCTTCATGAAGCTGAAAAGAAACACCAGGCTTTGCTTTTGGACACAAACAAACAG
gtgaaatgtggggtttggttactgggggagctggagagtgtattttgatcatggtaaggc
ttttttttttttccaaaaaaaatcaatattctgggttattactatgctatataatctttt
aaaaggtctcacattaacttcacgatcttttccccaggtccctctcttattttatcagtt

Exon 23 +      50738      50899   0   Internal    162   100   Excellent
ttggccaggatggccttgaactcctgacctcgtgatctgcccaccttggcctcccaaagt
gctgggattacaggtgtgaaacactgcgcccagctgttttttgtttttctgactattttt
ttttagctgtgcctcctggctaaagtaacattttggttttttttgtttgttttgctctag
TATGAAGTAGAAATCCAGACATACCGAGAGAAATTGACTTCTAAAGAAGAATGTCTCAGT
TCACAGAAGCTGGAGATAGACCTTTTAAAGTCTAGTAAAGAAGAGCTCAATAATTCATTG
AAAGCTACTACTCAGATTTTGGAAGAATTGAAGAAAACCAAG
gtatgttcactttaatttgcttcatgatttcgaatggtttatacaggtggtagtgatttt
aatggtatagcattaaacgttttcattttcattttatgaaaatttttggtagtcaaaaat
gatgtcattcatcagttctctgctgagttatctttaaaaaaaatcagtgggtcatctaca

Exon 24 +      53151      53313   0   Internal    163   100   Excellent
tggggggacttaggaaactgagtagagaacgtgaatggttttgtgcatctttagatgttt
tgtattgaatctaataattcttaaatttacaatatatgaatcttatatcttataattatt
tttccatatgcttataaaaagaaattcaaggttttaaatggaattacttttattttgtag
ATGGACAATCTAAAATATGTAAATCAGTTGAAGAAGGAAAATGAACGTGCCCAGGGGAAA
ATGAAGTTGTTGATCAAATCCTGTAAACAGCTGGAAGAGGAAAAGGAGATACTGCAGAAA
GAACTCTCTCAACTTCAAGCTGCACAGGAGAAGCAGAAAACAG
gtgggtgttaactggggcacatcaactagccagaactcttttccagtagtgaaataacat
atggtatgcgtgcataggaactatttttagtgctgtgttctattactgagtgctgatttt
ttaccattaatccattttccaatttctgaattttgtgcttatcttgggatcattatagga

Exon 25 +      54843      55009   1   Internal    167   100   Excellent
atgatatacctcccgaacaagagttgtttgaactataagaacatatacagatatatctcc
ccaacctcttaaaaaaaaaaatcaaagaaagaacacgtctaagattatctgcttcacgat
gcccattgttaactagagaagcatcaagttgcacatgatgtgttgctttactttggacag
GTACTGTTATGGATACCAAGGTCGATGAATTAACAACTGAGATCAAAGAACTGAAAGAAA
CTCTTGAAGAAAAAACCAAGGAGGCAGATGAATACTTGGATAAGTACTGTTCCTTGCTTA
TAAGCCATGAAAAGTTAGAGAAAGCTAAAGAGATGTTAGAGACACAA
gtggcccatctgtgttcacagcaatctaaacaagattcccgagggtctcctttgctaggt
ccagttgttccaggaccatctccaatcccttctgttactgaaaagaggttatcatctggc
caaaataaagcttcaggcaagaggcaaagatccagtggaatatgggagaatggtagagga

Exon 26 +      56215      56274   0    Initial     60    50    Marginal
actctagcccaaaaatagttatctatctctcactggtaatttttatatgtagttaaagtg
tgaaaaaaacaaaaacaaatgctgctttagttagccctgaatgcagttctggagtgtgtg
ttgatacactaactcttagtatccctgggattgactttctttcctgggtcatccaaagtc
ATGTCACTTCCTTCTGTGGAAAGAGACAACGTGAGTGAGTGTGAAATCACCTTTAGAAAG

gtcagtttctctcctcccacctacatgagagtgctggcctgaagtagctgttaccatttt
acatttcccccctttccctttctttttttttttatcttttatttttccattataccctcc
ttttttccccaacccaattttacaataaggcctgctggcattctttagatcttagaaaaa

Exon 27 +      56760      56853   1   Internal     94    49    Marginal
tttgattcaatttggtgactcccagggcaactgtgaagtgtaatccattgaccacagtgg
ctaggacaaagtattttttggagtttgcattatccttgttaaaaccacctaatgaatatc
ttttccactgtagatagaattggacctagcagtgctgacagttattttttttgcccttag
GGTTTGCTGACATCCCGACAGGAAAGACTAGCCCATATATCCTGCGAAGAACAACCATGG
CAACTCGGACCAGCCCCCGCCTGGCTGCACAGAA
gttagcgctatccccactgagtctcggcaaagaaaatcttgcagagtcctccaaaccaac
agctggtggcagcagatcacaaaaggtaaactactgtcaacatccgtctactgtttgaga
tccagaaaattgcagtagtacctgggtgaggattggacactgcacccccgattcaggagc

Exon 28 +      61501      61704   0   Terminal    204    72        Good
gtatcctcctaagttctctgttagatggggcctgttctcaaggaagaggaaatacttcaa
ttatatataactcctagagaagaagaacttaatttaaaacttagtgacatagtgctttat
ttttcatgttgtggaaatgtgaatgtgattgaacctctaacagagatgtttgtgttgcag
GTCAAAGTTGCTCAGCGGAGCCCAGTAGATTCAGGCACCATCCTCCGAGAACCCACCACG
AAATCCGTCCCAGTCAATAATCTTCCTGAGAGAAGTCCGACTGACAGCCCCAGAGAGGGC
CTGAGGGTCAAGCGAGGCCGACTTGTCCCCAGCCCCAAAGCTGGACTGGAGTCCAACGGC
AGTGAGAACTGTAAGGTCCAGTGA
aggcactttgtgtgtcagtacccctgggaggtgccagtcattgaatagataaggctgtgc
ctacaggacttctctttagtcagggcatgctttattagtgaggagaaaacaattccttag
aagtcttaaatatattgtactctttagatctcccatgtgtaggtattgaaaaagtttgga

--------------------------------------------------------------------------------