--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (5879 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        912        990   1   Internal     79   100   Excellent
gcaatataagaaagagaagacattgaaaacattgggaagaggcagtaacagagtgccaga
gaagataaggcagctgggagggggagaaactaagtgaggtggataaactaaaagcatcct
tctgggttaaagcagactaaaagcttagcaattgcttaatatcaccatcttatcctatag
ATGTGGGAATAAAGGCTAAGGAAGGAGAAATGAAAATGCAGAATCATATGGGGGCTTTTC
CAAGGAGGTATGAAGGAAG
gtgaggacagggagagcggctggaagtcagggggtaagagaaactctaaaaatcagggct
tgagggaaataaaaggtgaggtaagaggctcagggctgtgggaggcacatttttctctga
aaagcagtttggatgaggaagagatttggcagttggaagagagaagaagtcactacaggg

Exon  2 +       1615       1873   0   Internal    259    92   Excellent
ttctggtggttgggactagaacctgaagccttaaggcagtcaaatgtgtcagacttcctg
tgttctttagactctaggttcttgttttctaaatcattttcattcccattcttcctaatt
gtctcctgcttctctctttatcttcaccatcttgcttttccactcttcacagccttccag
GGGCCGACCTCCTTTCATGTTATCCAGACCTCGTCCTTTACCAATAGTACCTGGGCACAA
ACTCAAGGCTCAGGCTGGTTGGATGATTTGCAGATTCATGGCTGGGATAGCGACTCAGGC
ACTGCCATATTCCTGAAGCCTTGGTCTAAAGGTAACTTTAGTGATAAGGAGGTTGCTGAG
TTAGAGGAGATATTCCGAGTCTACATCTTTGGATTCGCTCGAGAAGTACAAGACTTTGCC
GGTGATTTCCAGATGAAAT
gtgagtctagtccaccgaactgggaagagtctcaaggactctcttttctctcttttttgc
aaagtgttgctctctctgatgcttctcccttcctttctattttacccaaatgcacgcaca
tgcttttcttgagtagtctctcactccagcttcacaccatcacacctcatatttcagatt

Exon  3 +       2539       2655   1   Internal    117    75        Good
cacatttttctcaatgctcttgtttctgaaaatgtctaaatgttatcattagtttttagc
tcatcatcattttacaccaaataactttatccccaccaaaatctaaaatcctaggttctt
ttctcatgcctttttttcttatttgtgtttaataacttgctctcttttccctctacatag
ACCCCTTTGAGATCCAGGGCATAGCAGGCTGTGAGCTACATTCTGGAGGTGCCATAGTAA
GCTTCCTGAGGGGAGCTCTAGGAGGATTGGATTTCCTGAGTGTCAAGAATGCTTCAT
gtgtgccttccccagaaggtggcagcagggcacagaaattctgtgcactaatcatacaat
atcaaggtatcatggaaactgtgagaattctcctctatgaaacctgcccccgatatctct
tgggcgtcctcaatgcaggaaaagcagatctgcaaagacaaggttagtcctgctgttatt

Exon  4 +       3021       3310   1   Terminal    290    86        Good
tcccaccacctcctctaagatcaagagtaggaagatatcaaaggataggagcttaaataa
caagttatttggttcccaaaggagtgaatggggtcgctgtccaagcttgtaggtttctga
gttcataacctctgaactcgagttataacatgacacttttttttctccttcctgccttag
TGAAGCCTGAGGCCTGGCTGTCCAGTGGCCCCAGTCCTGGACCTGGCCGTCTGCAGCTTG
TGTGCCATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGC
AGGAGCAGCAGGGCACTCAGCTAGGGGACATCCTGCCCAATGCTAACTGGACATGGTATC
TCCGAGCAACCCTGGATGTGGCAGATGGGGAGGCGGCTGGCCTGTCCTGTCGGGTGAAGC
ACAGCAGTTTAGAGGGCCAGGACATCATCCTCTACTGGAGTAAGAAATAG
cagggacccaggctggaaatgccaggaagtgatcttcaggcatagagggaggcactgggg
aaggatagagcttgagagatgaaagagggagagattgattgattgatttccctgacccca
atcccaacaggagtaaaaatagataatccaagttatcaaaaatgtaggaattaaggacct

Exon  5 +       3655       3748   2   Internal     94    51    Marginal
taggaattaaggacctgtaaactgggtagaggggatcaaaggatggatatatggtggcca
ggaatatgagagaggaagttggaaatgaccatacattggaagtaggtgggcaaaggaagg
ccaaggaattctgtgtatagtatctgaagtgacatccttttgtcctctctcaattgccag
GAAACCCCACCTCCATTGGCTCAATTGTTTTGGCAATAATAGTGCCTTCCTTGCTCCTTT
TGCTATGCCTTGCATTATGGTATATGAGGCGCCG
gtgagttgtgggtggtgttgtttttttttttaatatgtcttttctgttcacccttccact
gttttttaccattttatctatttaaaaattgtttatcctcaatcctttcaccatatcctt
tccccaaactcccattcgttttatgtggacttaaaaaaaattctgttaaaatacacataa

--------------------------------------------------------------------------------