--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (34393 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1296       1427   0    Initial    132    68    Marginal
actcctgggggcggggcgaggccttggagatgcgtccggaggcggtggggagcgaagact
gacccggggccgtgacgcgggggcaggccctggggcgggggcgggtcctggggactgggg
cgggcggccgaggcccggaagcggactgaggcggcctggagtcttagttggctactcgcc
ATGGACGAAGCGGATCGGCGGCTCCTGCGGCGGTGCCGGCTGCGGCTGGTGGAAGAGCTG
CAGGTGGACCAGCTCTGGGACGCCCTGCTGAGCCGCGAGCTGTTCAGGCCCCATATGATC
GAGGACATCCAG
gtgcgcccccggccccctgtccccgcgctgcacggccgggtccccacgcccctcgaggag
gcgttgtgcgggagcctagccttccctgtggcttcaaacccctcagcggagccaaagaat
cccaaacacctcttagtcgggtgttcgctaaagcgattccatgccatactcagtcagcgt

Exon  2 +       7101       7394   0   Terminal    294    79        Good
ccctgcaaaataatgaacagatcagcaaaggctggtaaatggcacacagtgcacctgcag
ctccattgctgcccacgtgcctgattgtttagacttacagtagctgggaaatggggagac
aaggtgagagccatataaaagtacgtggataattagtatcctgcctttctttccaaacag
CGGGCAGGCTCTGGATCTCGGCGGGATCAGGCCAGGCAGCTGATCATAGATCTGGAGACT
CGAGGGAGTCAGGCTCTTCCTTTGTTCATCTCCTGCTTAGAGGACACAGGCCAGGACATG
CTGGCTTCGTTTCTGCGAACTAACAGGCAAGCAGCAAAGTTGTCGAAGCCAACCCTAGAA
AACCTTACCCCAGTGGTGCTCAGACCAGAGATTCGCAAACCAGAGGTTCTCAGACCGGAA
ACACCCAGACCAGTGGACATTGGTTCTGGAGGATTTGGTGATGTCGGTAAGTAG
caagagagtgattggtgggtgggcatgacacgtagtcatttgggactcactatgagtaca
gctgggtgggctgagattcagaatttaattttagcattgtctttctgaatgttcataggg
atggcaaaattctgggaggttttcaggaggttgaatcttggcagcccctcctctgaaaag

Exon  3 +      18436      18597   0    Initial    162    98   Excellent
tgctagtcttccctgcagttgcttctcttttgccctggaatgccgggtggagaccctgct
actccttgtgcgagagggcagaccccgttttcttcccgcctctccagactgtcctctagg
gagcgtggggagagcccgggtttacgtgggtccctgtgctggcaggcttacatcctgagc
ATGGAGCCCTGTGGCCACTGCCTCATTATCAACAATGTGAACTTCTGCCGTGAGTCCGGG
CTCCGCACCCGCACTGGCTCCAACATCGACTGTGAGAAGTTGCGGCGTCGCTTCTCCTCG
CTGCATTTCATGGTGGAGGTGAAGGGCGACCTGACTGCCAAG
gtacactcactatctgtggagggagacagggtggggggcagtgggtggggaagtatcttt
tgagggactccaaaagccagctgactccccaggcgagcccttacatctggaggaccatgg
gaggtaggacggcccagcggctacaggttcaagttcagacgcagaagtccgggtttgagg

Exon  4 +      19417      19506   0   Internal     90    86        Good
ccaggctggtctcgaactcgtgacctcaaatgatccacctgccttggcctcccaaagtgc
tgggattacaggcgtgaaccaccatgcctggccaggctgggcccttttattgttaggaac
ggtccagtctgcatctagacctatccgtgcttctggctcacctgcagccctctcttgtag
AAAATGGTGCTGGCTTTGCTGGAGCTGGCGCAGCAGGACCACGGTGCTCTGGACTGCTGC
GTGGTGGTCATTCTCTCTCACGGCTGTCAG
gtaggaagcctcccactgttccctgggcaggcattgggtactggccgtgccaagaggctg
tgcaggggccatgtcccttcttgtgtccaaaacacccttggctttgtggaaaagggctgt
ggggccctgcccacctcctgttgttttcttgggagccatgtggtcctctgaggagttggc

Exon  5 +      20738      20885   0   Internal    148    92   Excellent
tcaaggtgtctttccagatgctgaccagggtctttccagaaccaacctgctctgtctcaa
tcagcctcgtgcccctggctttgaccttccaaatccttggctcccacaaaacctctgaac
aggctgttggattcctactccaacttcttggttttgtaaccagggttcttggtcttctag
GCCAGCCACCTGCAGTTCCCAGGGGCTGTCTACGGCACAGATGGATGCCCTGTGTCGGTC
GAGAAGATTGTGAACATCTTCAATGGGACCAGCTGCCCCAGCCTGGGAGGGAAGCCCAAG
CTCTTTTTCATCCAGGCCTGTGGTGGGG
gtaagcagctcctcagcctccctctgggtgggtctggtggggagggagccgccacctgct
tctttctccagcctgcccctcacagggcccatgaggtctctccaggcagtcagagggtac
cacacatggtccctttttggcagcacctctgtctggctggagcaggccctgctctgtctg

Exon  6 +      21678      21805   2   Internal    128    89        Good
gattctttgtagttttgctgtatgctctaattttaaacttaactcctattacagtgttat
ctgattttcttataaaaaaagagggaagagagacaaacatggggttcctagtttgtgggt
catgacaggaatatcagggagcgctagaaattctgtcccagggagtcccctctgccctag
GCTCTCCACGGACTGGAACATTCAGAAGGTATATCAGTTCCTTGCCTCCAGCCTGATCTG
CCAGAGAAGTGAGCACTGTTATACCATAGCGCTGTCCAGCTCGTCCAGCTGTGACATGGG
CACCTGTG
gtctatttctcctgtgcacatccaactgccccatccctattccacgttggtggagttggg
tggaggctacctaggagagcagtctctggtcacatcattcatccagtaagtgtttattga
gcaccatctgtatataccaggctgtgcgttaggtgctggggataggggaaaaacagagtt

Exon  7 +      25413      25521   0   Internal    109    68    Marginal
gatcacagtcacattctccaggagtgtttttgcaggggaccctctggatcactcctactc
caacttcagcctatttttaaaaaaatttctctttttttttctgcagtatgtatacatagt
taaatatatatttatattttttaaccaaagctcttgttagatgccttctttcctgagtag
CCCTCTGTGCTCCGCCTTACCCCACCCACCATGAGCCCTACTGCAGAAGACCTCATCCCG
GAAGACCTCCGTCAGTGTCTCCACTTCAGTAGCTCTGTAGCTGAGCCAT
gtggggcacaagtcctgccaggacctctctgttttccaagcttggcactgcctttgggga
gtctagattttaaaatggaaaagacaaaaaatatggcaacctaaaaaagaaaataattca
gaatgttataagctaatacagccatctcatttttgcatcttccttttggattccagccca

Exon  8 +      25939      26116   0   Internal    178    70        Good
catggccttcatcatcactagctcaaatggctttataatgggccattttcatgacatgca
ctaatttactaaaccattttcctaatgtcggccatttaggtgatatctaatttttggctc
acacaaccacaggtgtcttcatatagaaagcttttgactgcatttgaattattttcttag
GAAATTACTGGATTAGAAGGTGTAAACATCTCCATGGATTTCATTATCCATGACTTGGTG
TCTATTTGGTATTTTTCTGATGGCTTCTTTGATTCTAGAAAAGGATTTGCCATAGTGCAA
GAAGTACAAATGATAACACTAGGACAAAATAGAGAGGGAACACAAGGAGAGAAGAAAA
gtaaaagtttggattccaaaaatacatcctaggatgtcctgcagctttctacagttctct
aatgtacaagtgaattaaaaatttaaggtatacaacgactgattttagagataaaatcac
tttgcagatgtaaagaaacatggaaaaatcccagccattggtaatagtagactcaaaaat

Exon  9 +      30044      30297   1   Terminal    254    88        Good
gcaggtttgcgtgacccagttcccagcttgacttttccgtttggcttaatgagtttgggg
tcccaagatttattttcctttcacactgttaatgtagtatattgcaccgactttcatatg
ttgaaccatccttgtctgtgtatttcaatgacaagaggtgtttgtttctgcttcctgcag
AGCAGAAAGACCATGGGTTTGAGGTGGCCTCCACTTCCCCTGAAGACGAGTCCCCTGGCA
GTAACCCCGAGCCAGATGCCACCCCGTTCCAGGAAGGTTTGAGGACCTTCGACCAGCTGG
ACGCCATATCTAGTTTGCCCACACCCAGTGACATCTTTGTGTCCTACTCTACTTTCCCAG
GTGAGCACATCAGAAGGGCTCGTCCTCGCAGCCAGTGGGTCTTCCCGTCTGCCCTAGAGG
CAGCTGTGTGGTGA
gagaaaagaccagggtatgagtcctggttctgtcttttgcccctctgtgaccctgagcaa
gttacttctctctgagcctcggctcaggctgagcgggcaaggatgcgcgctgcaaggagg
cctgcgcccttgggttcctatgcctcacttgcctctcctctgcctgaccctgcctctgcc

--------------------------------------------------------------------------------