--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (76543 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (21 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3796       3865   0   Internal     70    54    Marginal
cctccaggatggcctccagggaccccgcctcctggtggccactgtccccatcgtattaga
gttggccttttgaaagctgtgagtccaagttgcctggcaaatagataaggaatacaaggt
gatcattcttaagacctcggggatctgcaaaccagccttctggaacctttgagcttccag
GATGATTCGGAATTTGGATGCAGCCACAGAAAGCCTAAGCGCCACAAGTCCCGCCATGAC
GCCCTGAGGC
gtgggttcacacttgggtgtggctggtcacgtctataaaaatgagccttcactttgggag
gcccaggcgagtggatcacaaggtcaggagatcaagaccatcctggccaacatggtgaaa
ccctgtctctactaaaaaatacaaaaaaattagccaggcatggcagcgtgtgcctgtagt

Exon  2 +       4562       4674   1   Terminal    113    70        Good
agctgtggtcagtgactccccaggagtcacacccagacctggggccagagccatccctgc
acctctgcctgatgtgacaccagggcggggcacaggctagtcccagctcctgcagccccc
gctgcacacccctacctgttagcacactgagtcctccctcattatcatcccattttacag
ATGGAGAAACTGACACAGGGAAGGCTGAGAGAATTGCCCAAGGTCATAGACCAGCACATG
GCAGAGCCAGTGCCAACTCCAAAGCCCAGATCCGAACCACTGAGTGGGCCTAA
cctccttcccaggaacccagactgatcgcctcaggtcacccaaaggggatggaatagtgt
catcaaccagctcccaaagaagatcagagcatgtgcagtcagcactggcaagatttcagc
ttagagagagatcctctccagcctcaaagtaccgactttggatcaagacttctcactaaa

Exon  3 +      13955      14092   1   Internal    138    62    Marginal
tccctttgcctgtgggtgtgggaccacgtgattttggatcaggggtcatttgtccttcca
gaagccaagccctgttccaggcatgggggtgcagcagtgagtgagacccacagaaccact
gccctcctggaacacaccccccccagagagggaactggggcaccacagacccgtgtgcag
GCAGCAAGGGCGTGGTGTCGGCCGGGGAGCAGCAGGGACCCCTGAGCCCCACAGTCGGGG
CTCATGGCGCTGAGAAGCACTGCAGCAAGGGCGCAGCCAGTAGGAGAGGAGCCGCAAGCG
CAAGCATCCGCAGACAGT
gtgagctcagcgtgctgggaaggcgggggcctgggtcaagggccaggcggcagagcatag
gggcctgagggggcagtgcctaggagtgggaggaaagagcatgggaccagattcactttg
gaaatagaagcccccaaccagcagccagccaggtggaggaaggcgtgcagagctgagagg

Exon  4 +      16456      16582   0    Initial    127    68    Marginal
gtctgtcctaagaagagccaggcgggcaggtgcgggtttgccagcacgcgggtgctctgc
acgtctgggttggagggttttcagccattgcccacaagcatattgcaaagcaagtcctga
agcacattcaatccaaaccaaccctcactcggaggttcaccacggaaaacagggcctggc
ATGGAAGGAGCCCTTGGTGTCCAGGAAACTGGCTCCGGGTCTCTGCCCCGTGGCCACCGG
GTGGCGCTGCTGCAGAGCACTTGGCACCGGCTGCGCTTCCTCAGAGACTGCCCTGAGCAG
GCGACTG
gtgggggcccgggggcatgggacattggtggttctttctgacctgcacctgctggggttg
atgccaactgtggactctctctcttctctccctttctcctttttctcttttctccattgc
tgtccgaagtactcggtatgggagtcccaaaagacagctccagttttacaggtaatgagt

Exon  5 +      17745      17866   1   Terminal    122    73        Good
cattgctgcatcttggcggtcaggccgggaggtctctctattcggacccggacatctggt
aacagtgctttggggatcgttgccaatgtgccaggcagtggtcatggaggtggcaatgta
tttccatgtagcttttctctccccgcgcccccactccccacccccccccccgtttgccag
CCATAGCACCTCTGATGGGGACCGTGGACCTAGATGCTCAGAGTGATCTGTGCCACGCCT
TCAGTGCCTCCTCGGAGGTCCTGCTCCTTACAGGGAGCTCTGAAGACATGGCCAACTCTT
AG
atcctactgaaattttggtagataagattttgcttaagatagttaaatctgaactccggc
ttgcaaatgctttccctggatgaaatgtttgtattgtgatgtatgtacacatggtataac
agatcctaacaaacatatgccgctcatcccaggggatttcatcagtgaaacaaaacatgt

Exon  6 +      26418      26639   0     Single    222    90   Excellent
ccaggggccgggtcccactcctagacaccaagacctggtggtggcactagttaaaggatg
tttcgctgcagctgccccctgccccagggccagccatccagcctggggcacgtggggcat
tggcacactgtctaactcatcaccgtctggacagtggcagctcccaagccaggcggcacc
ATGCTGTCCATGACGTACAGCGAGAGTCTGCGGAGCGTGAGCAGCAGGTGCCACTCTGAA
TGGGCCCTGCACCCCGTCCGCCAGACGGACACGCTGGAACTGCAGCGGCTGCGGGAGGTG
CGGGCGGCTGCCCAGGCCAGGAACATGGAGAGCTTCCTCCGCATGCACGGCCTTTCCCTG
GACGGCTGCACCGCCCAGCGCACAGGCATGAAGTATCGGTAA
gggccgggcaggggggcggtggggtgggaagtctgatttcagccatataaatatgtataa
aagggctgggcacggtggttcacacctgtaatcccagcacttggggaggcagaggcgggt
ggatcacctgagatcaggagctcgagaccagcctggccaacctggtgaaacaccacctac

Exon  7 +      28185      28352   0   Terminal    168    51    Marginal
ctttgtatcctaaatccagctgtaaaggaaggacaaagggtccgctagtttggccacagc
tgacctccttgttctgctggaaatttctcaagaaggagacgctgggcattcatgaggggc
tggtcattgattccttttgtttattcagtaaatgtttattgagagtctgcttggcaccag
GCGCTGAGCCAGATCCTGGAGCTGCTGCATGAACAAGAGCAACCAGGTCCCCAACCTCAC
GGCAGCCATGGCCTGGGGGTGTGGGGGGCAGAGAAGCAGCGAGCTTGCACGGAGACAAGT
TCCAACAGCGACCACTGGCCGAGGCAGCAAAGCAGGACAATGCAATGA
agaaagaccagggaggccgagggggaaccctctgagagagggatcatctgaagatgtgga
gaacattccagcccaagaggagaggggtctggaatggatgcctctctcagctggaggagc
gaagagaaggcccaggcggctaggctggagggaggaaggtggaggacacaaggcgatgat

Exon  8 +      37405      37483   0    Initial     79    59    Marginal
atttctaccttgggttctcaaaaaagaacacaatgtgagctaggaaacgccattccccca
gtaagtgggcatttgtctagcagctgtttgtgtcccttagtatcatatcataaggaacat
aaattagtctttcctgggtccattgatccaatatttattgaaggcttttgggcacgtgac
ATGGTGCTGGACGGTGGAGACACCAAGATGACCACATGCAAACTGCTCCCCACCCCCTGG
TGTCCCTGGGAAGAACATG
gtcagtggcgctcggagaagggaggggttacttgtgctgggggcctagcttcatagcgca
cacacactgtctgagctgatgtcacaagtgactccgagttcaaaggcagagaaacaggaa
aggcacttccacagggaacagcaggaatagaagcccagagggttttcaggcaggtgactt

Exon  9 +      40946      41157   0    Initial    212    69    Marginal
gcagccttcttccccaccgttgccttcggaaatcctcactcctcaaggaatgcctgcagc
ttccttggcttctggataaagtctcgtcctggtcgggggagaagagtttcttggggacag
atggctcctgagcccaaggggacaggggacgcagccaggatctgagcacccggcctcagc
ATGCAGGTGTCCTTCGTTTGCTCGGAGCACAGCCTCAAGGGCCGGGGCCCTGAGGATCGG
CTGGGCCGACCGGCGGCCAGCAGTCCCAGCCTGGGCTCCCGAGGCCGCTTCCGCGCCGTG
GCCATGGTGGCCCGGAGCCTGGGACAGCTGTCGGTGCAGAGCCTCCCGTGTGCCGGTGAC
ACCAGCGTGAAGCAGCAAAGGATGAAATATAG
gtacgggggcacacagctttgcagggtgggggctgacctcccggcctccccaactcccca
cctcctcactttcgagagcgcataaaatctgcaaatccccatttgtcagacttgggcagt
ttgtgctgagggccgggaggggctgtgcttagtgcttggtagatgatgagaaacagcgtg

Exon 10 +      47636      47679   2   Internal     44    61    Marginal
ctttacccccggggtgggtgagcagaggcacctctctgaaggtccccggtgcctttcgga
gcctccaaacacacattgactgttgggggagtgggtggggggctggccctggcgggaact
gagcctggctggcagggtcctgcctgggtgctgagaactcacgtggcgtttgtttttcag
GAACCTGGGCAAGTCTGGCCTGCGGGTCTCCTGCCTGGGACTTG
gtgagtgtgggggtcccctccgtcccaccagggaaacaggctgtggggaggccgggcatg
gactgaactggacaccccttgggaggcagggtggcccaaaccttggcactccccagggag
tagctgcacccagagcccaggattcaggggggctcggttgccatggcaacaaagaggcag

Exon 11 +      48614      48651   1   Internal     38    88        Good
agagcaggactttctctgaaggccagctgtccacacacactaaggacaccctggccacag
agcagcacagagggacacctgtggctgccccctgtgccctacagcctgaggtctgagcac
cgacgggataatctggcttcctgccaggttcctaacttgagcccctgtgtctccttccag
GAACATGGGTGACCTTCGGAGGCCAGATCACCGATGAG
gtaagatggggctctcccagcaccccagaacccagcacgggctcgccagagcacatggtt
aagtctgccgcgtggaccagtgagcacgtgctcccgggagccagcgcagcagcctccctc
cctctttctgttttgtgagggcgccctgccccaggggagagtagaaaggtgagccaggtg

Exon 12 +      53621      53778   0    Initial    158    43    Marginal
aggccgagtgttggggagaaggggatgcaggggatagagctgggggtcagggtgcagatc
tggtggagactttggctttgaccctctgcgagatggaagcccctggagggcttttgcatg
gaggaaatttgacctgatttaaaaggtctgccaaggctcgccctggctgctgcactggga
ATGGCGAGTCATGAGGATGTCCCAGAGTTCAGCGTGTGCACGATCCCATGTACTCGGAAG
GCACATCCTGATGTGGCAGGGCTGTCGTGGAGCCTGGGAGGCCGCATTTCTGATCTCATG
CTGATGCTGGCCCATGGACCACGCTTTGCCTGGGGAAG
gtgcagggagagaggatggaagcagagagctaggaggctattgtgagaaaccacccaaga
gccgctggaggctcagagcagggtgggcaccgtggaggtggggagacgggtcagattctg
gactaatttgcaggggaagccgcggcaggggctgaacttcaggctccagtgatgggagga

Exon 13 +      57051      57155   2   Internal    105    91   Excellent
cttctcaatgggtttgttactgagagctgcctccatccctgtcctgtggcaggagagggc
aaggagacagcccacaggggagcctgtcgggcccgggagggcagggcctggacacgggga
ggcctcccaggccgagagggtggtgctccagagcctctgggccccacccccggctggcag
GACAGTGTCGGTTTTCTCGTTTCAGATGGCAGAGCAGCTCATGACCTTGGCCTATGATAA
TGGCATCAACCTCTTCGATACAGCAGAAGTCTACGCAGCCGGCAA
gtacgtgtcttttcacacgggaaaaagtggttcagaatgcctgggcagagccggagctac
agggattcctgccgctcgcgttcccaagagtgctcacaaatgcaccttgcaccctgcttt
catttttaaactctgaatggctttaggaggtgctattttcatggggctggaattgcagaa

Exon 14 +      60085      60129   2   Internal     45    53    Marginal
actccctcgggccaaccctgtctgtggaatgagctactgagccaaggcgggtgttaacag
cctggctctctggccccagtgacattttcacagagggaaccaagtggccagtggccacag
tgggtctgggtttgatttttctgtttggctgtgatgagagctcggtgtcttgttttgcag
GGCTGAAGTGGTACTGGGAAACATCATTAAGAAGAAAGGATGGAG
gtaacggccctgctctctgcggcctgtccctggggtgggtgcgggcgaactatcccaggg
tcagcctcgtcggcctgtcgtgcagtgtcgtaaggcccgcaagtccccacatctttcttg
ctgggaagtggagaggaaaattcagttctccaagagtaggaggtgactctgcttgagaaa

Exon 15 +      62348      62392   2   Internal     45    52    Marginal
cgcaccccggctgggcacgtggtacacatcatatgatggagaagtgcccatttcatgccc
caggctcctgggtgggagggctttcaggacctctgtgtgagagatgaggacgtcggggat
gaaggaggaccccccaggggccgggcttatcacaccccttctttctcttctgttccacag
GCGGTCCAGCCTCGTCATCACCACCAAGATCTTCTGGGGCGGAAA
gtaggtgcaacagctggcgatgcttccagccccggcccagcagccacggccccgtgctcc
ccagagacccctgacctagaaggctcctggggtggcgggaggacagtcctccttgagaag
ggagagtggtcggggtctgtcctggacaggccccggcccagtgccatttcctgtccccag

Exon 16 +      65270      65360   1   Internal     91   100   Excellent
ctgtgggatgtgcccccacctctgccgtggcatttcacgacctccatcagcttctggaag
cttccagatgccagaggcctcttctccatctcttgttccctgagccgggcatggatgggc
ccaggtgcctgtggagatggagccacagcagtgacgcccccccacctggtcctcccccag
GTCTGAAAGCTTCCCTGGAGCGACTGCAGCTGGAGTACGTGGATGTGGTGTTTGCCAACC
GCCCGGACCCCAACACCCCGATGGAAGGTAG
gtggtctgcggcggcgccaccggttaggcctgggcggggtctgaagggtctgaacctggg
gttgtagaggccgccagcatgggccctgctgggcacccgggtgagccgtgagaggaggcc
gggtccagggtggggggcgagggggcaggcctcccctcagtagggggtgaactcagcctc

Exon 17 +      69281      69386   2   Internal    106    71        Good
tttcatcccaaaaaacccctcccacacccaacttcagagccaggaagtacactgcttgca
agacatcttcgcagcccctgtccctcctcccagcgtcctgcctgtatttgcagaatgtcc
cgaggctggccctgagccctggctgccccccacctgcggtttccctttctctcacgacag
AGACCGTCCGCGCCATGACCCACGTCATCAACCAGGGGATGGCCATGTACTGGGGCACGT
CACGCTGGAGCTCCATGGAGATCATGGTACGGTGGCCGCGCAGCAT
gtgtgtgtccaggcacagactcccggcaccggctgcgtatggagaccccaaagctctggc
ggggtctgtgcctttggtcccaactgcaccgatgcctgggtgctaagggagggacaggat
ggtggagtgtggtggttatgtctgtaggccttgcagacggggattctgcatggatcccag

Exon 18 +      70204      70324   0   Internal    121   100   Excellent
agctcaccagggcctgcctggctcccagggaagctatgagtgtgagcagtggggagcccg
ggctgcagctgctgggccagcctgctccggggacaccttggtgccctctccatggctgcc
ccggcagcctcccgcctgctcacaggcaagggccctcggggtccctttctgccttcacag
GAGGCCTACTCCGTGGCCCGGCAGTTCAACCTGACCCCGCCCATCTGCGAGCAGGCTGAG
TACCACATGTTCCAGCGTGAGAAAGTGGAGGTGCAGCTGCCGGAGCTGTTCCACAAGATA
G
gtgggcaccctcgggcccctcgccccgccccaccccacccctgctctcgggcccagggct
tgactccacctgcttttcctcttcaggagtgggcgccatgacctggtcccctctggcctg
tggcattgtttctggcaagtacgacagtggcatcccaccctactcaagagcctccttgaa

Exon 19 +      70411      70505   1   Internal     95    95   Excellent
aacctgaccccgcccatctgcgagcaggctgagtaccacatgttccagcgtgagaaagtg
gaggtgcagctgccggagctgttccacaagataggtgggcaccctcgggcccctcgcccc
gccccaccccacccctgctctcgggcccagggcttgactccacctgcttttcctcttcag
GAGTGGGCGCCATGACCTGGTCCCCTCTGGCCTGTGGCATTGTTTCTGGCAAGTACGACA
GTGGCATCCCACCCTACTCAAGAGCCTCCTTGAAG
gtgaaggaacagcctggtggggagggacgggcaggggataggcattttggacgggtggga
cctttgggccgactgctttggtgctgggcaggggttccgggagctgcagctgttcccacc
tcggtctgctgggggcgggctccttggcgtgagaacatggagcccctcctggcctgatcc

Exon 20 +      71517      71643   0   Internal    127   100   Excellent
ctgcccactctcccctacttgagaggcctggggcaggggcactgccctggcttcaagatg
agaagagcccctatgagggagaagggtccagaaggaatgagcccatcggccccctgcacg
tgggggtccaggtgacctgctctcatctgtagctgtgctgctcccctcccccgcaaccag
GGCTACCAGTGGCTGAAGGACAAGATCCTCAGTGAGGAGGGCCGGCGCCAGCAAGCCAAG
CTGAAGGAGCTGCAGGCCATCGCCGAGCGCCTGGGCTGCACCCTGCCCCAGCTGGCCATA
GGTAACG
gtggggtcgccatggggccagtgcccctggggagaacctgccccagctggccgtaggtaa
cagggtggggttgccatggggccagtgtctccggggagagagggaagggatccctggaca
tcatcccccagccagcctcgggtaatcgggctctaaggggcatggttgggaccccatgcc

Exon 21 +      72150      72238   1   Internal     89    90   Excellent
ccatgcctcctccagccacctcttagacaaagcccgtgcccagcactgcagggcttccta
gaccccctcagacccccagaccaagatgctgggtctctcggcccagtcagaggcaaggca
gacccatcaggggcccctgtggtgggtgtttctccctcaccttgggtctcgccgccacag
CCTGGTGCCTGAGGAATGAGGGAGTCAGCTCCGTGCTCCTGGGGGCCTCCAATGCGGACC
AGCTCATGGAGAACATTGGGGCAATACAG
gtaagagtgagaggccctgctgggcagagggcccatcccagcccgagccccgtccagtgc
atcctcccaggctcgtcctgcgtgccaggctctgttctaggcactcaggatgcgcccgtg
aaccatcagagttgtgctcctggagagcttgctttccagcaggaacagacatgaacacta

--------------------------------------------------------------------------------