--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (75452 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (51 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1753       1788   1   Internal     36    60    Marginal
aatggaagtatccttcagggcccgggccgtgggggggggtgtgcgtcatgagggagggat
tcggggtgatcacagagcacaaacttcctacaggagggccagggaggcctggcacttaga
catggggtgaactcacagaattgagtgaggagctgggggaaggagccctcggctaagcag
GAGAGGAGGAGGAGGAAGAGGAGGAAGACGAGGAGG
gtgggggaggaggaggaagaggaggagggtgggggaggaggaggaagaggaggaggagga
agaggaagagaaggaggacttggtggggcttcctgggcctgagtgggccacccaagtcct
ggatgacaaccagagatgcctactgaccacctatgggtggggcctgtttcatggggactg

Exon  2 +       2868       2929   0    Initial     62    51    Marginal
tctgctcctctgcgccctgcccctgtggccctcctcttttctcaaacactggaggttact
gggaagagaatgggatttttctgtcaagcccaactacgtaatatgcctccccatccaccc
ccaaacaactccctcgcttcctcccttgctttctctagctctttccagacttgctgccta
ATGGGCCAGAAAGTCGAGAAAGCCATGGGCCTGGGGTACCCTCTGGAAATGGCTGTGGCG
GG
gtgggtgtgtctgggaggggtgaggtgtgatgggtgtgagcacgtgcacaccagcatgtg
cacatggctctggaaattcagcattcatctctccatctctccttcccagtcctactcagt
gagttctcaaccttaccctgcatcaacccttaccctcccatgccatttatctgggtaagc

Exon  3 +       3498       3603   2   Internal    106   100   Excellent
acctggtcctcactgtaccctgcaggggctcagggaaggagcagcgtgggcgagcgtcca
tgagcctgtccagcagcctggcatcagagtcacagtccagactgaccctcagcgccctca
tccccttaaccctgtaagtcccttgcctcactcgagggctctccttaaccctggctccag
GCCCTTCGAGACGATCATCTTGCTCACCATCTTTGCCAATTGTGTGGCCCTGGCCGTGTA
CCTGCCCATGCCGGAAGATGACAACAACTCTCTGAACCTCGGCCTG
gtaagattggcccttccatctcccttcctgcgagcctgcagccccaggcttggggaggcc
cccttggtggactctgttctgggggatggtgccggtggttcaactccctgacgatgcagg
ccctgcatccccagccacctgcagggctggctgagtggctcaatgggtttccagggtcaa

Exon  4 +      13117      13236   0   Internal    120    50    Marginal
attaaatgtatgcatgtggccagaatagggccgggctcataagcgggtgcttactaaagc
ttagctattattatcctcattacccaagacagcactggtctccctttctctcccagcccc
cttcaccctgagcatgcagagccctactgggaccctcagccccattgtccctctgtctag
TCAGCCCTGGTGTGTCTGGCCCACCCAGACCTGAGGGAGCTTGGTTCCCTGGTAAGGGAA
GTGCTGTACAGGGAGGGGAAGAGGGAACTGGAAGAGGGAAATGAGACCCCTGAGACAGAG

gtaggatggcaagggatacccattccagttacgtctatttgggtgagcgttcgttgggct
aaacatagccacttccctcactcctcagcaggtcatcttccaaacctggaggctgaggtg
tttgtggagatgccagggccctggacacccagtgtgcggcgtggccatagaggccagcac

Exon  5 +      19746      19885   0   Internal    140   100   Excellent
gtggcagtgtgggggcatgtaggtgtggagtgggggggtaggcattccatcagcaagtgc
aaacgtcctgaggtgggcgtgcctgagcaacagcagggaacccagcacggctgcagggaa
gagagcaagggtgcactcagagagcacagaggcatgctgtgaccacgtttgctcccacag
GAGAAGCTGGAGTATTTCTTCCTCATTGTCTTCTCGATTGAAGCCGCCATGAAGATCATT
GCCTACGGCTTCTTATTCCACCAGGACGCTTACCTGCGCAGTGGCTGGAATGTGCTGGAC
TTCACCATTGTCTTCCTGGG
gtgagagctgggtgtggggagactgaaggtcagaccctcgctgaggactgtgtgcccact
gccaccaccaccagcatcttagaggtggggtgggactccagcattgtgctaaccactgca
tggagcagcctctgttagaggccggcccagcaagggagctgtccatgttggtggagagtg

Exon  6 +      21653      21795   2   Internal    143   100   Excellent
agtgaaattccccagataagcatgatcagatcatttgttagttgatgcacccgtatttgc
cgtctctcccctaggcctttccacaggtgctcaagcatggacaggacacagggcctcaga
ccactggggcagtggcttttccaacccctggaccccctctctccctcttctccattctag
GGTCTTCACCGTGATTCTGGAACAGGTTAACGTCATCCAAAGCCACACAGCCCCAATGAG
CAGCAAAGGAGCCGGCTTGGATGTCAAGGCCCTCAGAGCCTTCCGAGTGCTCAGACCCCT
CCGGCTGGTGTCGGGGGTGCCTA
gtgggtggcagtgtccctgcagacccctttctcctctcccttcctgttcccttgtccccc
agttctgggtccccttcctaccttgacatctcaggggcttcccaggatttatagggaggg
agggccaagagaccaagcagaggcgactcctcttttcccttccctgcctgcctctgcagg

Exon  7 +      21975      22127   1   Internal    153   100   Excellent
agtgggtggcagtgtccctgcagacccctttctcctctcccttcctgttcccttgtcccc
cagttctgggtccccttcctaccttgacatctcaggggcttcccaggatttatagggagg
gagggccaagagaccaagcagaggcgactcctcttttcccttccctgcctgcctctgcag
GCCTGCAGGTGGTCCTGAACTCCATCTTCAAGGCCATGCTCCCCCTCTTTCACATCGCCC
TGCTGGTCCTCTTTATGGTCATCATCTATGCCATCATCGGGCTGGAGCTCTTCAAGGGCA
AGATGCACAAGACCTGCTACTTCATTGGTACAG
gtgagctcccagggaaagtggggctgtggggcagggcctaggatggctcagaagggggag
ccaccctacctggtgaaggagcccggagctcagccattgccgcccacatctgttgacctt
gagaatgggtttctcctggataagggggacttggaggaagggcagctctactggagtcag

Exon  8 +      24304      24509   1   Internal    206    99   Excellent
agcccaaggcattcctcttcactgtcaccgtctgctccatgtgaagctgtcttttgcatt
ttcagcagagtgtctttagacttactgctcaattctcttaaattgctcttatacaccttt
cctcctgtcgttgtccacctactactgttgtctgatgttccctttgccttctgcctccag
ATATCGTGGCCACGGTGGAGAATGAAGAGCCATCGCCCTGCGCCAGGACGGGCTCAGGGC
GCCGGTGCACCATCAATGGCAGTGAGTGCCGGGGCGGCTGGCCAGGGCCCAACCATGGCA
TCACCCACTTCGACAACTTCGGCTTCTCCATGCTCACCGTGTACCAGTGCATTACCATGG
AGGGATGGACTGACGTCCTTTACTGG
gtgggtctgggcccgcgcctgcagaaccatctcccttcatccacaggcttgcaagggagt
ggggagggagggcttgccagtccacacaggaggccagtctctgacttgcgtgaccacagc
tccctcttgctcctccctggggaatctatacaggatgtgtgtccctttctggttcccagg

Exon  9 +      24689      24788   0   Internal    100    66    Marginal
ggtgggtctgggcccgcgcctgcagaaccatctcccttcatccacaggcttgcaagggag
tggggagggagggcttgccagtccacacaggaggccagtctctgacttgcgtgaccacag
ctccctcttgctcctccctggggaatctatacaggatgtgtgtccctttctggttcccag
GTATGTGCCCCAGCATCCTATGGGGAAATCCCCATGATACAATATGTCTGTGCAGGATCC
AAGGGGCGGGTGAAGAATGGAAACCAGGAAAAACCTGGCT
gtgagtgactcaattctgatggcttagaatttcacactttttgaggaacgaagggccctt
tgagtctttttccttgcctctgcaagactgctttcccatataactattattagatattag
tttcctcacctataaaataaggataataatactgtctatatcagagttagtgggagaatt

Exon 10 +      25755      25941   1   Internal    187    97   Excellent
ttggagggaaattaggtcagtcttgcccgggccaggtaggcagtcagcaaggtctcccta
gggagatccttccagaccagatcctagtcctcaggctggaaaagttcttccagactagtc
ctcaggttaggaaaaatgtcccctcaatatcccagcgtggcttctctccttgtcccccag
GGTTGGGTGGAGTCTTAATGAGCAGACTTGGGGAAGAGGAACCAAGCCCTCAACTCAGAG
GATCACACTTCTGTCCTGACCAGGTCAATGATGCCATCGGGAATGAGTGGCCCTGGATCT
ATTTTGTCACCCTCATTTTGCTGGGATCCTTCTTCATCCTCAACCTGGTGCTGGGTGTCC
TGAGTGG
gtaagaaattcaaaggtagccaggggagaaaagagaaagaggaggaggggagaaggagga
ggaaggaaaaggaacggagggaaaagaaacaggaggggtggggggcgagtggagaggagg
aggagagaagggaggaggaggaaggagtggagcagggcagggggctgtgagtcaggccct

Exon 11 +      28186      28331   2   Internal    146   100   Excellent
aagtgagaggggctgtctctcagccaccttgaggggcacctggaccccaggcaacacccc
ggggccagaaaaaggagcgctccagtcacagaatgggcttgtctgtcctcaggaagctca
gtctttccttgacactgttccctcttctcctcctctcctggctcccccatctcatttcag
GGAATTCACCAAGGAGCGGGAGAAGGCCAAGTCCAGGGGAACCTTCCAGAAGCTCCGGGA
GAAGCAGCAACTAGATGAGGACCTTCGGGGCTACATGAGCTGGATCACGCAGGGCGAGGT
CATGGATGTTGAGGACTTCAGAGAAG
gtttgggcccaaaggctgtggtcagcactcaccccactctctcactcccacctctgagtc
ataccttgcaatcaggcccactgagcaagtccaacattagtcctttgagggtgagtgact
tgcctaaagcaaaatggctcaaaatggtaagatccaggtgtgaccagagctcttcccaaa

Exon 12 +      28736      28817   1   Internal     82   100   Excellent
tgggctctttagctcttggaactctcagtctctggaaagcacgaagcaatccaggcctac
ctaggacccattgttgcagatgtctctggtcaatgggcccttgtctcgggtgcccagtcc
aggtgtgtccagcccagaggggccccgaaggctggctgactctttctctcctgtctccag
GAAAACTGTCTTTGGATGAAGGTGGCTCTGACACAGAGAGCCTGTATGAAATTGCAGGCT
TGAACAAAATCATCCAGTTCAT
gtgagtatctgcccactgccccaggaacccccaacccccagctccctgagacatgagggt
agagtccagttacttcccctcagtggtttcagagtcacttgtctaatcctttagaaaggc
agcctttttaagaaaatagggccagttcctgctctgagggactccgcagggaccagatcc

Exon 13 +      30445      30605   2   Internal    161    98   Excellent
tgaaagatggaggattttactcagtctggctccctagctcatgccctgagcttctctcat
gtggctggcggaagtggggtggtcaggctacgcatgcctggagtttgtctgaaggtagct
tggacaggtggggcgtagaacagcacagcactgtagaccatcctctgtcccctccctcag
CCGACATTGGAGGCAGTGGAACCGCATCTTTCGCTGGAAGTGCCATGACATCGTGAAGTC
CAAGGTCTTCTATTGGCTGGTGATTCTCATCGTTGCCCTCAACACCCTGTCTATCGCCTC
AGAGCACCACAACCAGCCTCTCTGGCTGACCCGTTTGCAAG
gtgaggcggaacggagtgaagccgggaggagggcacatgtggctgtggcttgatgtcaaa
atcagccaatggcaccacaggttgtgcagaagaggtcaattagatattgacatcattttt
ctaaaaattatggaccatgagtgctggattatatgacctaatcagctcctttcacggggg

Exon 14 +      32281      32403   0     Single    123    54    Marginal
gatttgggcagggctgtctatccaaacgatatcaggccttatatgtgaataaagtgttgg
actttacactttaggcaatggaaagccagtgagaagttaaaagcaagaatataatgtgat
cagacttgagtcttggaaagatcagtcttggtggaaggtcagtgagtcggcctcgtccac
ATGGTAGATGTTCACCTGGGTGTGAAGCTCTGGACCGTGAGACGAGTAGGATACGAGAAA
AGACTGACCAGTTCCAACAACACGGTGGACAAACTCAGTGCCCTCCCCACTACAAACAAG
TAA
cactgctgcataaggcataagaatgatgtttcctggaatgaaaaggaagtcttttagtgg
cagaaacaaagaagtgacccaaagccagagcagcgagcttgtgaactgacttccaaggac
attttaggcctaggcctaaaccctaatgggtagcagctgggttcctaaggcctgtgcagg

Exon 15 +      33340      33504   0     Single    165    44    Marginal
agaggtaaaagaaggaaaataaatagaaaacaagattatctttttctatgggaatgaaat
aggaaacaaagctagttttaaattactagctacaggtcagatgaattcattcattcattc
atctcaaccaatcttctcgagagcaccgtgaatgtgccaatcgttgtcaaaacactgtca
ATGACCAAATGTGGAGATGATGTGAACAGTGCCCACCAAGAGGAGTCAGGGGTGATTTTG
AGGTTTGTGACCTATGCAGATAAATGGCTAGTAGTGCCACCTACTGAGAAAATGGTTAAT
GACCAAGTATTTGGGGTAGTGGGGGAGGATGAGCAGTATCCCTGA
gctttgtcttgggcatggtgagtttgatgtgcctttgagacatcccaatggatatgtcaa
ggtagcagacagaaaaataggtctggaactcagcagagcagtctcagctgaagaactaaa
tctgggacgcattggaggggatggtctgaagctgtggtcttagataacaccagatctcca

Exon 16 +      35663      35888   1   Internal    226   100   Excellent
gtgccacttcactccagtctgggcagagtgaggccctgccccctgcacccccaaaaaaca
tccatggtgccttggaaacaagggaaggggcgtcctgggttgaggcccagccacagccaa
ggctgggagtcaggagaagggaaggagagtgatgccggggctgtgccaccaaccctacag
ACATTGCCAACCGGGTGCTGCTGTCCCTCTTCACCACTGAGATGCTGATGAAGATGTACG
GGCTGGGCCTGCGCCAGTACTTCATGTCTATCTTCAACCGCTTCGACTGCTTCGTGGTGT
GTAGCGGTATCCTGGAGATCCTGCTGGTGGAGTCGGGTGCCATGACACCCCTGGGCATCT
CCGTGCTCCGCTGCATCCGCCTCCTGAGGATCTTCAAGATCACCAA
gtgagtgccggggtcggctggcactcccgggtccccggcaggcaccacgggctggtctgg
tctacacccatctcatttcctgaggtctgggatctgtgcaggttcaccactggtcccttg
cccagacttccctccctccttgaaataacctccttctgtgaaaaaagaatcacttcccca

Exon 17 +      36640      36847   2   Internal    208   100   Excellent
gtgctctgcaggaaggagagagtgggcatgcagccatgaatccagggtcttccagcagtg
aggcagccccctccctctgtgtcacatcagtcctgagtctttcccccaagcctgtccaca
cctcgtgggccccagtgagagggtctgtctcctcccaccttgtgcctcctcttccttcag
ATATTGGACGTCGCTGAGCAACCTGGTGGCATCCCTGCTCAACTCCATCCGCTCCATCGC
CTCCCTGCTGCTGCTGCTCTTCCTCTTCATCGTCATCTTCGCCCTCCTGGGCATGCAGCT
CTTTGGGGGGAGGTATGACTTTGAAGACACAGAAGTACGGCGCAGCAACTTTGACAACTT
TCCCCAAGCCCTCATCAGCGTCTTCCAG
gtaggctctccctctgcgtgtccctccttctgaacggttgctgaatcctgcttcttgtcc
ttcaagatcaaggtgggcatcaccttctccaggaagccttgtctgatctgctggttgagt
gcaatgtccttctctgggctcccctatcacctgtgcttctctccattgtaacacttgctt

Exon 18 +      38152      38272   0   Internal    121    97   Excellent
ttccccagctggaataggggttttggggatagcaggggctggccacccagactgtggaat
gaaaagagggaaggtctgagagaaccacagagttggaggagaacttcggtcaatgcggtc
ccaatagaagactctcaggcccctctgtgttcccgagccctctatcctccctccatacag
GTACTGACAGGGGAAGACTGGACCTCAATGATGTACAATGGGATCATGGCCTACGGCGGG
CCGTCCTACCCTGGCATGCTTGTGTGCATTTACTTCATCATCCTTTTCGTCTGTGGCAAC
T
gtatcctctcgggagcagggtgcagaaaagagcttagggagggggtgggggaaagggctt
aaaatgggggtcaagggtgtccagtttctaggtagccaggccctctggctggaggggagc
tcccaggcccatgcggtagggggtaggacatagcaaatgcaggtacagctgtaggataat

Exon 19 +      39147      39261   1   Internal    115    94   Excellent
ggtactctcagcaggcaggcttccctgagggccttccactatgtccctggatccacacct
tcccatgggtagctctgggagagtggggttaggtcctgcccacatgcaggcagacagaac
tcctgccctgcaggctcccttccacctacaaccaaaggctccttagctaaacccgctcag
ACATCCTGCTCAATGTCTTCCTGGCCATTGCCGTGGACAACCTGGCCGAGGCGGAGAGCC
TGACTTCTGCCCAGAAGGCCAAGGCTGAGGAGAAAAAACGCAGGAAGATGTCCAA
gtgagtgcttccttagcaggaagggacctggagtgctcagtcgtggccatggccttccag
ctctggacagggcctccctgtaacccaatgatcagggtccctgacatggtgacacccacc
tcagtgggcaaacttctgtaacctgcacatgggggtggctgagatccttccctgggggca

Exon 20 +      40125      40218   2   Internal     94   100   Excellent
ctctcaccacagagaagggacttgcctgagcccactgcccttcccatttgggggctgatg
ccactcctcctacagatcccctggagcccttggtgtgggatcctcctgaaggtgttgtca
ggttcagcagatccctgagaactttctggtttggcttccactttgggttttctaactcag
GGGTCTCCCAGACAAGTCAGAAGAGGAGAAGTCAACGATGGCCAAGAAGCTGGAGCAGAA
ACCCAAGGGTGAGGGCATCCCCACCACTGCCAAG
gtgagcacctcaggtggggatgttagaggcagtctaggggctcttccaatccatggttcc
cttcataccacagggtacaggtggggtagggtggggaggtaggagagttatcagccaggt
gagggcatctccctgcgtacgactggagggagagccagcgaatccatctccagggactcc

Exon 21 +      40922      41043   0   Internal    122    87        Good
gtgggagcttttgcaagttgtctggccttgctgggcctggcctctcatttgtaaaatggg
gatgatcataatattccctgttccttaggctgtagggatgattaagtgagctgaacgcta
acaggctctccagtatatgctcattgaggggaaaccgcaacttctttttcattgttatag
TCATTGTGTTCCTTCCTACAGCTGAAAATCGATGAGTTTGAATCTAATGTCAATGAGGTG
AAGGATCCCTACCCCTCAGCCGACTTCCCAGGTGAGGATGCTGGAGACTGGACTGGAGCA
GG
gtgctggggtgaagtaggggtgtgccggtcctgaattctccccatgggcagtctcttgtg
tgtccctacctgtacccctccatgtggagatcagaacaccggagacatcccttctgtgca
aataagccatctgccagcttgtctctctcaacaatgcacacaacagaaaaacccatacat

Exon 22 +      41882      41983   0     Single    102    40        Poor
caccgggtcagtggggcaattttagatctacttgtcccatcagctgatcagctacttgta
tgtctacttatggaatcagctgattagcatctgtttgccccagtgactctaagctccagg
gggacttttgtgttccacacagcacagtgtttggctcagaggaggcactcaataaattga
ATGAATGAATGCATGAAAGAATTTTGCAAAGTGAAGTATGGGGAGAATGGAGCTGGTACA
AATAAGAATAATGAAATTTCTTCAAATATCTACCAGCAATGA
atatttgtgttttagaataactcattttgagttgtttcatctaacagttatcacctctta
gatggcagtgacttgtgtgcaggtgagatggtggctgacaggaaatctgaggtcagggac
aaggaaggggctggaaagaagtaaggagaggaggggtagagggggtgtgggctggacagc

Exon 23 +      42031      42123   2   Internal     93    68    Marginal
tttggctcagaggaggcactcaataaattgaatgaatgaatgcatgaaagaattttgcaa
agtgaagtatggggagaatggagctggtacaaataagaataatgaaatttcttcaaatat
ctaccagcaatgaatatttgtgttttagaataactcattttgagttgtttcatctaacag
TTATCACCTCTTAGATGGCAGTGACTTGTGTGCAGGTGAGATGGTGGCTGACAGGAAATC
TGAGGTCAGGGACAAGGAAGGGGCTGGAAAGAA
gtaaggagaggaggggtagagggggtgtgggctggacagcaggaagagagtcttaccaag
gggactgaatgtgtttatatcctgcttctttctaaaaatagtttgaaatggcttacagca
aaagatatgtgcaatgaaattaacaaactgggcataggtggaggaagtaagaaggcgggg

Exon 24 +      43363      43495   1   Internal    133   100   Excellent
ctcactgtgaagagaaggagatgcccgggctggactctgccaaagccctagggtcccaag
tcagcctggtggtcccttgcttactggctgcaggggctcctaggagggctctgagcacag
aagccatgggcatagcaaagcatgggaagacacccctaattcctctctctctccccacag
GGGATGACGAGGAAGATGAGCCTGAGATCCCGCTGAGCCCCCGACCACGTCCCCTGGCTG
AGCTGCAGCTGAAAGAGAAGGCCGTGCCCATTCCAGAAGCCAGCTCCTTCTTCATCTTCA
GCCCCACCAATAA
gtgggtgccccttggctgctgtgggggtgattgatgcggctctcatctgcttccctgccc
tagaaaaaaccctgtctgactctccatgcctacagttatactatgagaaactcagtgttt
tagcttaagatcttgtgccctgtttaaaatgctagtatatctgggaaaagtaatgcttta

Exon 25 +      44059      44116   2   Terminal     58    75        Good
cattttcatttgatgggaaacctcagggtggtgccataattgcaggaaggggcaggtggt
gggaggggcttggctgggaggaggaactaaggctttagaaacagagtgagaggtcagggc
cccctgtgtgtccagccagaggaccctgcaggtgcagggctgcacttctctcctggccag
GGAGGAGCAGGAGGTGTATTCCATGTTCGTCCGCAGGATGGAGGCTGATGAGGCCTGA
gcctccagcagctcacagctcccctgccctccctacctcgccccaccaggatccgtgtcc
tgtgtcaccgcatcgtcaatgccacctggtttaccaacttcatcctgctcttcatcctgc
tcagcagcgctgcactggctgcggaagaccccatccgggctgattccatgagaaatcagg

Exon 26 +      44166      44295   2   Internal    130    90   Excellent
gagaggtcagggccccctgtgtgtccagccagaggaccctgcaggtgcagggctgcactt
ctctcctggccagggaggagcaggaggtgtattccatgttcgtccgcaggatggaggctg
atgaggcctgagcctccagcagctcacagctcccctgccctccctacctcgccccaccag
GATCCGTGTCCTGTGTCACCGCATCGTCAATGCCACCTGGTTTACCAACTTCATCCTGCT
CTTCATCCTGCTCAGCAGCGCTGCACTGGCTGCGGAAGACCCCATCCGGGCTGATTCCAT
GAGAAATCAG
gtgacgggcttcaccctctctgccactcagcacccctgccccctccagcctcagtctggt
gcccagggttcagctgtatcctctatgtggctacaagcatcagagtttcttagagttcag
ttcctcagggataggactgcccactccactccttctgaacggcacaggctggggcacaga

Exon 27 +      44571      44630   0   Internal     60   100   Excellent
agcatcagagtttcttagagttcagttcctcagggataggactgcccactccactccttc
tgaacggcacaggctggggcacagaatggctctgactgcctgctttatgctgctgctgct
gctgatactgttgccccctcctcctctcactggctgctcccgcccctgccctgtccccag
ATCCTTAAACACTTTGACATCGGGTTCACCTCTGTCTTCACTGTGGAGATTGTCCTCAAG

gtgagtgaaggctgtggggcagccctggggagggagtttccctgatgtggctccagttta
cacacactgaactcaggggctggagagaagcagaaaagaggtggagactggcaggaaaga
ctcatgggacccagcacaccggcaggcccacaagtatctggatggagggctggaaagtaa

Exon 28 +      46774      46880   0   Internal    107   100   Excellent
gcgagcagagataggaaatgcatttaggccactgcaaggagttgagtgaaatatagagat
ttctggaaggctattgcctcagtaagtgctctcctgagcagaggcgagaagcccttgtct
gtgggagacaggcctgttctccaagctcctccatccaggctgctgcctctttctccccag
ATGACGACCTACGGAGCCTTCCTGCACAAGGGTTCCTTCTGCCGCAATTACTTCAACATG
CTGGACCTGCTGGTGGTGGCCGTGTCCCTCATCTCCATGGGACTTGA
gtgagcagcggcaagggccagccctgggcacagaccaccctctgctctgtgccagggctt
tgtagtgggagtcccacccatgttggtgggcccctgccacaagaggagggtctctcgggg
cctccgatggaggcagggggtcctgtgggttgtcaccagctggaatgtgggttgccacca

Exon 29 +      47451      47538   2   Internal     88   100   Excellent
tggctgtgccctggagtcgggcacactctcacggctggaggaaagggaaggggaaggtgg
gagtgttttcaggcagaaaggcagctggtgtggagggcaggatatggctggaggctccac
cgcagactgggctggctggagcaggctgccctcagccccctcaccattgccgccccccag
GTCCAGTGCCATCTCCGTGGTGAAGATCCTGAGGGTGCTGAGGGTGCTCCGACCACTCAG
AGCCATCAACAGAGCCAAGGGGTTGAAG
gtgagagagggcccgggcaggagccccagagaggaatgggaggggttacaggggcctcct
cgctccagaaacctcagcccagccatggctgggacccctgtcccatctccctgggcagat
aggggtaaggatgaggctggggtagctatgcttccccaccagcctttccccacctccaac

Exon 30 +      47822      48022   0   Internal    201   100   Excellent
catctccctgggcagataggggtaaggatgaggctggggtagctatgcttccccaccagc
ctttccccacctccaactcatcaggaggcagcaagtcttgcactcctggggtttcctcaa
ctgggctagcagggttactgtgggtgcacccccagtccccattggcccctctgtccccag
CACGTGGTGCAGTGCATGTTCGTGGCCATCAGCACCATCGGGAACATCGTGCTGGTCACT
ACCCTCCTACAGTTCATGTTTGCCTGCATCGGCGTCCAGCTCTTCAAGGTGAGCCCCAGC
CTGCGCGAGCAGCTCCCCCTCCCGCTCCCAGCCCTGGTGCCCACTCTCAAGCACAAGGAG
CCCCACATTGTGAAAACAGAT
gtcttcgaatgcacagatttccatatgagaatattttattttgaaaaataggtcttcacc
acaccaaacacataagtttgcagaaagccagtaagacatcgttacatttaaatagcacct
tgagttccacaaaagcagcccaatgataatctcagaaacagtcaatgggcttctaacact

Exon 31 +      48776      48908   2   Internal    133    53    Marginal
cagtttcctcagtgacatccatcccgggcctcttggttgactgctgaccactgttgccat
tgtatctgctctctccctaccccacgtggcttttccttggggagggaggcccctcctccc
agggccccacagccattcttctcccttcccacccttgcccgcttcctcccatcctgccag
GCCTGTGCCAAGCATACGCCCTATCCCAGCCCCACACTCCGCCTCCGTCAGTGCAGCTGG
GCTGCGGCAGCCCATCTTCCTGGCTGGTATGTCTGGCATCATCCACATCTACCAGGAGCC
TCTAAGGCTGGGA
gttcatcatctcacatccggagccaaccttatacttttctcattttcctaggagaacaca
gctattcagttcctctctaggaattagccctacaaagatgtccctcacacaaaccctgat
ttccagatgtctctggctctcagatcatttgcaggacagagaaattgattcctaagtata

Exon 32 +      51253      51305   0   Internal     53    90   Excellent
ctctggggccctgccccaagggcgagttcacgcctctgagaggaagagatgggcttgggc
tccttttttcagatgcctgccttccctccccccttccactgttcactcccagagcccact
tttctatcctgtttccatgacaacatgcctccctccctccctccctcttcctggctgcag
GGGAAGTTCTTCAGGTGCACCGACTTGTCCAAGATGACAGAGGAGGAGTGCAG
gtacatggggcagggagcacagtgggacggtcacggggcagggagcatggtgggacagtc
acggggcagggagcactgtgggagggttacggtcacggggcagggagtgtggcaggacga
tcacagggcaggggactgtgtgttggtggatgacggcccttcaagctggaaactggggaa

Exon 33 +      51605      51823   2   Internal    219   100   Excellent
atcacagggcaggggactgtgtgttggtggatgacggcccttcaagctggaaactgggga
agctcagcctttaggcttaggagggacactcacagaggcccctttcctcggactcgccca
gcggtgtccccttgggtcccagatctggaacttcatttctccttcacactccccacccag
GGCCCAGAGGATGTGGGTGGGGCAAGGCAGCCCAGCCATGCCCTGTGGAGTGACTGGGCC
TCCCTGCCACAGGGGCTACTACTACGTGTACAAGGACGGGGACCCCATGCAGATAGAGCT
GCGTCACCGCGAGTGGGTACACAGCGACTTCCACTTCGACAATGTGCTCTCAGCCATGAT
GTCCCTCTTCACGGTCTCCACCTTCGAGGGATGGCCTCA
gtgagtgatggctggggcctaggtccctcatggacatggtcaggtaggaccaggcagcca
gcctgcccttctgcagcccccacggtgctactgctacctgtggcaggcgtccaacaaacc
caccaactctctgatggtttgatggtatgttgactggtcactccaaagtaggcctgacca

Exon 34 +      52299      52500   2   Internal    202   100   Excellent
gccattccaggattgggtctggtctttcctggcgccgacctaactcctgtcccgtaactt
gattgttgagaaggctctcttggctctccacagccagtgggataaagcccatccttccca
gcctgactctctgccttgtcaccccacccagtctgtcctctcttctctgcccacccccag
GCTGCTGTACAAGGCCATAGACTCCAATGCGGAGGACGTGGGTCCCATCTACAACAACCG
TGTGGAGATGGCCATCTTCTTCATCATCTACATCATCCTCATTGCCTTCTTCATGATGAA
CATCTTTGTGGGCTTCGTCATTGTCACCTTCCAGGAGCAGGGAGAGACTGAGTACAAGAA
CTGTGAGCTGGACAAGAACCAG
gtgcctgggctgcctgccagaggtggagggcagagctccagcaggcctcctgctggccca
agccctaggttcagccagggaagagaggcctaagggtgaccccagaacctgcatttgatg
ccaagccctagcctccatgcaccctaccctatctccaaactgaagcaatacaagttggta

Exon 35 +      52951      53109   0   Internal    159    94   Excellent
tgtgataactcaaggggaacccaaagcccaacaggattattcccctaaacagttcacagt
cctcagccacagcccctggccacagctgctcctgacttgcccgtcaatcccatggatgtg
ggtgtggagagggagggaggggcctcttggtgctgacctgtcctgttgtatgtgtcacag
CGCCAATGTGTACAGTATGCCCTGAAGGCCCGCCCACTGAGGTGCTACATTCCCAAAAAC
CCATACCAGTACCAGGTGTGGTACATTGTCACCTCCTCCTACTTTGAATACCTGATGTTT
GCCCTCATCATGCTCAACACCATCTGCCTCGGCATGCAG
gtaagggctccccaggagaaaaatgtctgatcagactgggacctgggccttgggtagggc
aggatgagtagggcaggatagccaggattccccccagtagacatttcttgtgcactgtgt
gctgaggtgctacatggaatacagaagtgaactgcgcacaggccttgtcaccaggcactt

Exon 36 +      54468      54620   0   Internal    153   100   Excellent
ttggcggaactcaggggattgctaaagcagcttctagttttctgagctaaaacaaagtga
gcagggggcccaagaaagggttgggggcttcccaggaagaggcaggggctctgggaatgc
aatctacagggtgggcaaacccggcccccctgacccactgctcctgtgtcccctccacag
CACTACAACCAGTCGGAGCAGATGAACCACATCTCAGACATCCTCAATGTGGCCTTCACT
ATCATCTTCACCCTGGAGATGATCCTCAAGCTCATGGCCTTCAAGGCCAGGGTGAGTGTG
GGGGCCACCGGGCCAGATGAGAAGCTGGGGCTG
gtgggtgggaccttccagtggaacatccacccccatccctcatcctatcagggctccttt
gcccagcacttctgctcccaacttgctcacccctttgcccacttccaccttcagacacag
ggcaggcagatcttcatgcagccagaattgacaatgacagaaagactctgggcgcctctt

Exon 37 +      55276      55359   0   Internal     84   100   Excellent
ggagtgttggagttgggggagcccactggagcaccagtgggaggtggagtcatgggcacc
ccaccttggcctaacccgcagctccgcattagctcgggtgggacactgtcctctgccagc
agccagagctccttcctcccaaagctcaccccctcgctttcccatccttttccttcccag
GGCTACTTTGGAGACCCCTGGAATGTGTTTGACTTCCTGATTGTCATTGGCAGCATCATT
GATGTCATCCTCAGTGAGATCGAC
gtgagtatcaggcaggcagagccatcactagggtgggcccaagagcatgtgttcaatcca
cagatatttgtggggtgcccactgtgtgtacaacatggaaccccaggggttaaaaagatg
gaatgacaagtcacggcttctgccctcaaggaactatcatcctgctgggcagagaggtaa

Exon 38 +      56433      56564   0    Initial    132    84        Good
gaacaaaattgtggaacaaactggcaataaataaatcaatctctaatatgacaggtatga
caagtacatagtattatacagaaacataaagggagttagaggcttagagtggaagagaat
gggagggtggtgtccatatgacactggagcagaggcctgaagaaagcaagggcatgagcc
ATGCCAGAACGGGGGCCAGAGTGTTGGCAGAACACGACAGCAGTGCAAAGGCCCTGCAGC
AGGATGGTGCTTGCTGAGTTTGAGGAAGAGCAGGAGGCCCTTGTAGCTGGAGGAGAGAGT
GGTGGAGATGAG
gtaagagagagaaggcaggggccagatcatctaggcccttgaaggccatggttatgatct
tggattttattctgagggagatgagaaccctttggagggtttaagtgtgaacagacttta
gttctaaaacaatcactgtggctgctgtgttgcgaacaaactaaactgtaggggacaaga

Exon 39 +      60180      60335   0   Internal    156   100   Excellent
agagccctgtgcccaaggatggtcccgaactagtggacagcaggggccagaggcggggct
ggagttcctccatgccacaaacatctccccaaaacacacagtgcacctccctccccgccc
tgccccttacccctctgaggttctgcccccagactgacctctggggctgctgccccgcag
GACCCAGATGAGAGTGCCCGCATCTCCAGCGCCTTCTTCCGCCTGTTCCGTGTCATGAGG
CTGATCAAGCTGCTGAGCCGGGCAGAAGGAGTGCGAACCCTCCTGTGGACGTTCATCAAG
TCCTTCCAGGTGCAACAGGGACCCTGGAAACTGCAC
gtacctggggaggccactagggacatctgcctcagcccagggtgggccccaggggagccc
tgggcaaggcagagccctggggagctaacagagggcagggctgcagacacacagtggagc
cctaagacactgactggcgctcccgcccgccctgcaggccctaccctacgtggctctgct

Exon 40 +      60493      60558   0   Internal     66   100   Excellent
aacagggaccctggaaactgcacgtacctggggaggccactagggacatctgcctcagcc
cagggtgggccccaggggagccctgggcaaggcagagccctggggagctaacagagggca
gggctgcagacacacagtggagccctaagacactgactggcgctcccgcccgccctgcag
GCCCTACCCTACGTGGCTCTGCTCATCGTCATGCTCTTCTTCATCTACGCTGTCATCGGC
ATGCAG
gtgagaggcaggcgggcccaggccaaagcatggatcttggccaagttagagggggcatca
gtggaccctgaggagcctgagcagcacacgggctggaccctccgccctccctgccttgct
cgtgagaaagaaggagggacaacctccctgatcgtggatggctggagtgtcagatgcttg

Exon 41 +      60980      61028   2   Internal     49    63    Marginal
aggcctgactggagccctgggtggcctctgtctaccctcccctgagagcacttcccccac
acattgacttaccgggtctgcttgctgctgggaaaacgggtctaccctccctcttttctt
tggcttgctaagaagaactttacctgatctagaaaataatcccgttttttttggcttcag
GTCTGATGTGGCCCGCAATGAAGGGAATTTTGGGGAAGTAGGGGCGAAG
gtaggggtcaggcaggagaaggcagtgggggataagctgaggggacactttaatctaggt
tccacagtcagggccctttgtgacttgcagatgtttgggaagatcgccttggtggatggg
acccaaataaaccggaacaacaacttccagaccttcccacaagctgtgctactgctcttc

Exon 42 +      61119      61251   0   Internal    133    87        Good
ttacctgatctagaaaataatcccgttttttttggcttcaggtctgatgtggcccgcaat
gaagggaattttggggaagtaggggcgaaggtaggggtcaggcaggagaaggcagtgggg
gataagctgaggggacactttaatctaggttccacagtcagggccctttgtgacttgcag
ATGTTTGGGAAGATCGCCTTGGTGGATGGGACCCAAATAAACCGGAACAACAACTTCCAG
ACCTTCCCACAAGCTGTGCTACTGCTCTTCAGGCACGCGTCTCCCGCCACCCCCACCCCT
ACCCCGCTGACCA
gtccagcctttgctctgttctaatgtgcactggagccagggctggcttcatgggtgtgtg
acctgtgcagccacacagggtcctatactcagaagggtcccctgcttggttgcatgctct
gccgtcactgccttgaagatattcatcattttgaacaagtggtcccacagctttattttg

Exon 43 +      62635      62783   1   Internal    149   100   Excellent
ggcccagctcacactgagctacacagtgaacatgaagatctgacctccttaccattggac
aacagccccagtttgctcatctgtccacaccctgctgccacctgactgccagccttctga
ggggccaggcaggagcagataggtgacaggagcctcttctgtcctctaggtgtgcaacag
GTGAGGCCTGGCAGGAGATCCTACTGGCCTGCAGCTATGGGAAGCTGTGTGACCCAGAGT
CGGACTATGCCCCAGGGGAGGAGTACACATGTGGCACCAACTTTGCATACTACTACTTCA
TCAGCTTCTACATGCTCTGTGCCTTCCTG
gtgagatgctgagggcctgcggggcagggagagggctttgataagctgaggcatggggga
gcctgcctgccccttcctggccagtttccacctctcctgggattcatctcggggacgcag
gaggctctagttaggttgtcccccattctggtcatcctgagtgtggctttgtttcctggg

Exon 44 +      63251      63378   0   Internal    128   100   Excellent
caagagcacagagacatgacagagcattgctgtgtgtgtgatgtgggtggttcagaaggg
ctagaatcaagggcacaggaagcgagaagttgtgggccagtggacacctcccagctcccc
caccctaaccctgtaccacctgcctttctgtgttgggaccccttggttcttctcttgcag
GTCATCAACCTCTTTGTGGCTGTCATCATGGACAATTTTGACTACCTCACCCGGGACTGG
TCCATCCTGGGCCCTCATCACCTGGATGAGTTCAAGGCCATCTGGGCAGAGTATGACCCA
GAGGCTAA
gtgagtccaatctgtaggctctgtgctgggccctccatcctagacccttcctaccgtctc
acagggagtcactctccagtttattcagtatgagtgggcttctccttcccccttcattta
tctgaggtctcagatcagagaatcagagtatctccaggttggagggaatcctacagcttt

Exon 45 +      65010      65185   2   Internal    176   100   Excellent
tggtgaggacctgatggagtgaagcattgtagagccgggatctcctgggtccccaagttc
ctcccaaagggcctgaagtctcagcaatgtcacccaactcatcattctgtcccctcacaa
aggatgtcctggtcagctgacacccccagccctcgtgtcccgtcccctcccggtccacag
ACCGGGTGAGGATGACTTGCCAAGCTTGGCCTGGTCCCAGCTCAGCGGCAGGCCACTGCG
TCTCCCTGTACAGCGGCTGGTGGGCATGAACATGCCCCTGAACAGCGACGGCACAGTCAC
CTTCAATGCCACACTCTTTGCCCTGGTCCGCACGGCACTCAAGATCAAGACGGAAG
gtgagagtgccttccaatgtgagccccctcctttctcccagaggctgtttctggcacaga
ttctgccagattctcagagctcaagattgctcttaagaactgtgggaagaagtagaggga
ggaccccaggccatgggcacaaagtcctcatgcccctcagggctcagagggagcctgagg

Exon 46 +      65377      65588   2   Internal    212    59    Marginal
ttccaatgtgagccccctcctttctcccagaggctgtttctggcacagattctgccagat
tctcagagctcaagattgctcttaagaactgtgggaagaagtagagggaggaccccaggc
catgggcacaaagtcctcatgcccctcagggctcagagggagcctgagggttttctgcag
GGCAAAGATCATCAAGGGTCTGTTCCCACACTCCTCAGCTGTGTCTGGGGGCCAGAGAAG
GGCCAGTGCTGGCACAGGGGTCAGGGGTGCCCTGCAGTTTGGCTGTGAGCAGGAGCAGAG
GAGGTTCTCAGGCAGCACTGGGCAGGCTGACGGGAGTCCACATTCGACTCCACTAAATCT
GCAGGTCCTCACCTACTGGGAAGACAAGCATG
gtgggagcaggggaaggagtcagggtggggtctcagtattgtctctgagcccttgctcag
ggctcacactgtatcaagctcaagtctccagctgtatcaggtccatccccacatggggac
cactccaggagtctgagacaacctcagggtgagcttcattagcagggcaagatgaggaag

Exon 47 +      66141      66242   1   Internal    102   100   Excellent
ccccagggggacagtgatgccctcccaccattgccagtacccagcaaggcagctgccaca
aaactcagccaatgtttcttagtaaatgactggctgtctgaaaggttcagaaagaactgg
gtggccttgtcaagtgcagttggtgtgatctgggtaacttttgcctttctcctgctccag
GTAACTTTGAGCAGGCCAACGAGGAGCTGAGGGCCATCATCAAGAAGATCTGGAAGAGAA
CCAGCATGAAGCTCTTGGACCAGGTCATCCCTCCAATAGGAG
gtaggtgctactttgggggaccagagtccagaagcagccaaggaatgggagtggggagct
tctccaaggagccccatgggaatctgagaacggaccagatcctccataaatgccttaggt
agatcccacgggcatccaacctcaggatggaaagtgcccagtgaccaagtcagcaagaca

Exon 48 +      66528      66671   1   Internal    144   100   Excellent
ataaatgccttaggtagatcccacgggcatccaacctcaggatggaaagtgcccagtgac
caagtcagcaagacaaaggattgcttgcatgcccgggcctggctacagctggctcccact
ctgaatccagtgtcagattcccactagccttcagggcatctcttgttggctcctctgcag
ATGATGAGGTGACAGTGGGGAAGTTCTACGCCACATTCCTCATCCAGGAGCACTTCCGGA
AGTTCATGAAACGCCAAGAGGAGTATTATGGCTATCGGCCCAAGAAGGACATTGTACAGA
TCCAGGTAAGCCCAATCCAGGTAT
gttccaaggggctcccccactgagccaggtctccagactctagttatccttccatgtcct
tgaggggccaatgatggagacatagagggaaaaaggaagcccagaagagtgaaaaaatgt
caagacagttctgggtagtccatgattgaagatgtttcaacctcaaaaaaagaaccaggg

Exon 49 +      69311      69439   0   Internal    129   100   Excellent
caggaggctgaggcaggagaatcacttgaacccgggaagcagaggttacagtgagctcag
attgtgccactgcactccagcctgggcaacagagtgagactctgtctcaaaaaaagaaaa
agtggttctggtctcctctcctgggctggagagataactgagtcccttcgtcatccccag
GCAGGGCTGCGGACCATTGAGGAAGAGGCAGCCCCCGAGATCTGTCGCACGGTCTCAGGA
GACCTGGCTGCTGAGGAGGAGCTGGAGAGAGCCATGGTGGAGGCTGCGATGGAGGAGGGA
ATATTCCGG
gtgagggagagccaggagcacccctagtggtctagacaccatgagtggcagtgtctcaca
gagaggagggctgggagcccagccacacgagagggggacatgggagctgaagatacccca
ctccgtctctccacttcaccacccacctctcctgggactcagaatcaatgacctgatcta

Exon 50 +      70236      70475   0   Internal    240   100   Excellent
aactttctaagggtgggaattttcttcttttgatctcaccactcagtccatcctcctttg
gccttataagatttgtctcccaatactattgcttgttcccaataccactgtcccagagtg
acagccccccatgccctccctgccctcacccccagtcactgctcttctccttgcccctag
AGGACTGGAGGCCTGTTTGGCCAGGTGGACAACTTCCTGGAAAGGACCAACTCCCTGCCC
CCCGTCATGGCCAATCAGAGACCCCTCCAGTTTGCTGAGATAGAGATGGAAGAGATGGAG
TCACCTGTCTTCTTGGAGGACTTCCCACAAGATCCACGCACCAACCCCCTGGCTCGTGCC
AATACCAACAATGCCAACGCCAATGTCGCCTATGGCAACAGCAACCATAGCAACAGCCAT

gtgttttccaggtagtggcggccactgccatccctgggtgtagaggtactgggaggacaa
tgtcagcaggttccaggttggattggaagagggtaccccaaatttgtagggtgtcttttg
cttgcctttgtgccccaatccatcctgaaccttaatgtaagaggccgacctcgatggcag

Exon 51 +      73685      73936   0   Terminal    252    71        Good
cagcaccagctacagccctgctgatccaaaaggtgagccaggggctgggtcacagcagtg
gctgcattgagtggtggccctgtgatggcctggcgtggagagagggtagggccaacagag
gcaggtccccaaatgtggctccccaggaagaccccactcagcctactctcctccctgcag
GCTCTGGTTCGAGGGGGCCTGGGCACCTTGGCAGCTGATGCAAACTTCATCATGGCAACA
GGCCAGGCCCTGGCAGATGCCTGCCAAATGGAACCAGAGGAAGTGGAGATCATGGCAACA
GAGCTACTGAAAGGACGAGAGGCCCCAGAGGGCATGGCCAGCTCCCTGGGATGCCTGAAC
CTCGGGTCCTCCCTGGGCAGCCTCGACCAACACCAGGGCTCCCAGGAGACCCTTATTCCT
CCAAGGCTGTGA
tgcccacacagcatcagcatgggcttagagctggcatgaccaatgggggtggggaagttg
ctggggtggagaagggctagcccaccgcagcagcctccctccctctcagcagctagatgc
atggcctgaggcagggtggtcaggaaccacctcaaaaagtgcggaggaagtagctggaca

--------------------------------------------------------------------------------