--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9755 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1562       1711   0    Initial    150    73        Good
ggtcttaaagactttgtccataagacgaagggccaaattaatgacatatttcaaaaactc
aacatatttgatcagtctttttatgatctatcgctgcaaaccagtgaaatcaaagaagaa
gaaaaggaactgagaagaactacatataaactacaagtcaaaaatgaagaggtaaagaat
ATGTCACTTGAACTCAACTCAAAACTTGAAAGCCTCCTAGAAGAAAAAATTCTACTTCAA
CAAAAAGTGAAATATTTAGAAGAGCAACTAACTAACTTAATTCAAAATCAACCTGAAACT
CCAGAACACCCAGAAGTAACTTCACTTAAA
gtaagtagaaaataaagagggttcatgtttatgttttcaatgtggatcttttaaaaaaaa
tatttctaaggcatgccatttgaaatactttgttgcattgttgaaatacttttttttcca
agaaaaataatctccagaaaataaaatttcctattataatttcaagttagttttttgttt

Exon  2 +       2346       2475   0   Internal    130   100   Excellent
taaaatgttaaggacaaaaatatgtgctatttgaaagaagcatacaaggggaaggaattg
ccaatattcatttttcaaatccattattagtttaaaaatttagattatgatagtgttaca
ggaaattaatagaaaagaaagaggaaagcaacttataaccaacctactctctatatccag
ACTTTTGTAGAAAAACAAGATAATAGCATCAAAGACCTTCTCCAGACCGTGGAAGACCAA
TATAAACAATTAAACCAACAGCATAGTCAAATAAAAGAAATAGAAAATCAGGTAAGTCAG
TATTTTAATG
gtatgtcccatctttcacacaggtctgtaaaaacactgaatcctaaaattatttacaagc
tttaactggatcatgagtaaaattatcacatcagcataactgttaaaattgcaggctctg
aagctaataaactacctgcatttaaaccatggctctaaaactttgtgtgaccttgaataa

Exon  3 +       5419       5532   1   Internal    114    74        Good
tggtaagatgattcttacattcttaaataacacgccatctaagaaaaatgctttaacata
aacattactgaaaaaatgctacatttgccacaacttcataaaatgtcaagtgaaatctca
agctccaaagatattattcctattactaaatctgatgtaataacattttattgattctag
GCATTCCTGCTGAATGTACCACCATTTATAACAGAGGTGAACATACAAGTGGCATGTATG
CCATCAGACCCAGCAACTCTCAAGTTTTTCATGTCTACTGTGATGTTATATCAG
gtaaaacctgtctaaggagaatagacagtagttagttcaacttactcattacgtattagg
aagattaacctggttatcattgttttatacatatatatatgaaatatatatgagtattcg
tataaatataatacttttaccttgtttatgtatttactcaatattctccttttcctctaa

Exon  4 +       5935       6030   1   Internal     96    84        Good
aattcattaattgcctttcacttaacttttgggaccataataaataataaaatgtattgc
cataacattaataaactaccttacaaaaccaccaattaaaatcaaacaaacaaaaaagtg
ttatttacatctgtcaacataaatctactaaaaatacatgatttcattcattatattcag
GTAGTCCATGGACATTAATTCAACATCGAATAGATGGATCACAAAACTTCAATGAAACGT
GGGAGAACTACAAATATGGTTTTGGGAGGCTTGATG
gtaaggggactacattcaatcattcattcacttgctaatctacaaatatttactgagaac
ctcttatggaccaggtattaggaaaagtagtaacgaacgagaagcagtctcagccttcat
ataatttattatcaaacaattacacatttgttagtaaattacacttattacaactgttat

Exon  5 +       7619       7899   1   Terminal    281    85        Good
gcacatagctatcttcaataaaattgttttaaaaggtattattttaagatacactaaaat
gatcaagggattcaagactaaacaactcaattagttgcaccaataaaaaacacttaaaaa
aactgtcagtgtccaacctgtacttaataactcacagatttttaaaacttttcttttcag
GAGAATTTTGGTTGGGCCTAGAGAAGATATACTCCATAGTGAAGCAATCTAATTATGTTT
TACGAATTGAGTTGGAAGACTGGAAAGACAACAAACATTATATTGAATATTCTTTTTACT
TGGGAAATCACGAAACCAACTATACGCTACATCTAGTTGCGATTACTGGCAATGTCCCCA
ATGCAATCCCGGAAAACAAAGATTTGGTGTTTTCTACTTGGGATCACAAAGCAAAAGGAC
ACTTCAACTGTCCAGAGGGTTATTCAGGTATCTTTTTCTGA
taccaatactttattttcatatcttcaaagtatcttcccacattattagctattatctgc
aatgacaacttttaaaaatccgaatcccaaataagcgttttctctctagacgaaaacctc
ttaactataatgaaagtgttcattctagttcaatcaggtattttacctctaatcttcctc

--------------------------------------------------------------------------------