--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22465 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1364       1497   2   Internal    134    89        Good
ctgcagctggttactgcatttctccatgtggcagacagagcaaagccacaacgctttctc
tgctggattaaagacggcccacagaccagaacttccactatactacttaaaattacatag
gtggcttgtcaaattcaattgattagtattgtaaaaggaaaaagaagttccttcttacag
CTTGGATTCAACGGTCCAAAACAAAAATGCAGCTGCCATTAAAGTCACAGATGAACAAAC
TTCTACACTGATTTTTAAAATCAAGAATAAGGGCAGCAAGTTTCTGGATTCACTGAATCA
ACAGACACAAAAAG
gtatttaatatttcttttatttaaaaatattatgtatagcaaatgcataactattttata
tttgtagtagaaatttcagaatcttttactaaacaaagacctttggaatatactacagtt
tatctcatctgaaaaaggttttatcttgcaacttgacataaaaacattaagtactgtgca

Exon  2 +       6462       7358   0     Single    897    84        Good
tttaagaaattaataaagttaattctagcctaatctattaacaccaataaatattcagtt
tttccctcagatagtttttaagattactgactttaacatagattaatatgaattcttttt
gctttttctccttcactgatttgtttttcaaaagacatcattttacaacctcatttcaaa
ATGAAGACTTTTACCTGGACCCTAGGTGTGCTATTCTTCCTACTAGTGGACACTGGACAT
TGCAGAGGTGGACAATTCAAAATTAAAAAAATAAACCAGAGAAGATACCCTCGTGCCACA
GATGGTAAAGAGGAAGCAAAGAAATGTGCATACACATTCCTGGTACCTGAACAAAGAATA
ACAGGGCCAATCTGTGTCAACACCAAGGGGCAAGATGCAAGTACCATTAAAGACATGATC
ACCAGGATGGACCTTGAAAACCTGAAGGATGTGCTCTCCAGGCAGAAGCGGGAGATAGAT
GTTCTGCAACTGGTGGTGGATGTAGATGGAAACATTGTGAATGAGGTAAAGCTGCTGAGA
AAGGAAAGCCGTAACATGAACTCTCGTGTTACTCAACTCTATATGCAATTATTACATGAG
ATTATCCGTAAGAGGGATAATTCACTTGAACTTTCCCAACTGGAAAACAAAATCCTCAAT
GTCACCACAGAAATGTTGAAGATGGCAACAAGATACAGGGAACTAGAGGTGAAATACGCT
TCCTTGACTGATCTTGTCAATAACCAATCTGTGATGATCACTTTGTTGGAAGAACAGTGC
TTGAGGATATTTTCCCGACAAGACACCCATGTGTCTCCCCCACTTGTCCAGGTGGTGCCA
CAACATATTCCTAACAGCCAACAGTATACTCCTGGTCTGCTGGGAGGTAACGAGATTCAG
AGGGATCCAGGTTATCCCAGAGATTTAATGCCACCACCTGATCTGGCAACTTCTCCCACC
AAAAGCCCTTTCAAGATACCACCGGTAACTTTCATCAATGAAGGTGAGTTACCTCTTACT
GTAAAAAGTGGGAGTATGAGGTTTATATTTTTATGCCTTATGAAACAATGCTCATAA
taaatgcttattcattttgcgatgttatatatgtacattaaaatttctattgttttttat
taatatcaagaattgaacttaaatacatctcctcttccagctctgaagttccaggagttt
ataaaaacttaatgtattctgtgaaaaaaaccagtcttccatccaaattcttatgatcga

Exon  3 +      17566      17616   0    Initial     51    51    Marginal
tcacaaaatgtgttgtcacttgtaaaatttgaagaaattattagtggattaaaaatggag
aatacctaaaattatgaaataacatgagggcaaatgcatgcaacacagcagttcagagca
gggactctgggattagacaaggatttatgtctatctagggtttaccatcttctgtgatac
ATGACCTTAGTTAATCGTTCTATCTCTAGAACATCTATCAACTATCACCAG
gtaactgtaggttaaatgagaaaattactattagtcatacagattgatacaactctttag
atactcatttatgctaacattcctgaaatgtattctcatgggctgttagtaagtgttgtt
gggggaaatttaagattctatgagtttgggcatctggtttatttcagggcttttcagtct

Exon  4 +      18451      18644   1   Internal    194    89        Good
ttaatgttccagatagaactggagtcacccttttatttagttatattttataatattgta
tatatgataaacaatggtaactgtaaacaaagacacaaaggtaaaaatcttgattaaaaa
cttttaacatgtctcttctcatattaagtttgctgataataaatgatatttaaattatag
GACCATTCAAAGACTGTCAGCAAGCAAAAGAAGCTGGGCATTCGGTCAGTGGGATTTATA
TGATTAAACCTGAAAACAGCAATGGACCAATGCAGTTATGGTGTGAAAACAGTTTGGACC
CTGGGGGTTGGACTGTTATTCAGAAAAGAACAGACGGCTCTGTCAACTTCTTCAGAAATT
GGGAAAATTATAAG
gtaaatcagtgatgcagacctaagggaagtaaaacaaatccattcttgcaataatgcaag
aaacaagatgctatgcaataaataagacacacagttaaaaataactatccatatgttttt
tcattatctacatctgtcaaaaaaatgattctcatctctggttttaaagtcaaaattaaa

Exon  5 +      19285      19608   0   Terminal    324   100   Excellent
aacaaaaagagaatgacaatgtgtggcttataaaacgcaagtgaccaactaaaatggaag
ctcacattaccacttaaatggccagtatctttatgctatcgaatgtttaacactgctctg
taaaaatgtttactatctctatacttatttatgcactcatgtttcttcacttattaacag
AAAGGGTTTGGAAACATTGACGGAGAATACTGGCTTGGACTGGAAAATATCTATATGCTT
AGCAATCAAGATAATTACAAGTTATTGATTGAATTAGAAGACTGGAGTGATAAAAAAGTC
TATGCAGAATACAGCAGCTTTCGTCTGGAACCTGAAAGTGAATTCTATAGACTGCGCCTG
GGAACTTACCAGGGAAATGCAGGGGATTCTATGATGTGGCATAATGGTAAACAATTCACC
ACACTGGACAGAGATAAAGATATGTATGCAGGTAAGTATGAAAAACTTTCATTCTTTGTA
GAATCATCACCTTCTATGCATTAA
atagaatctactaatatatatgctactaaagtcttttcaaaaaggtcagttttggtcact
gtggcaggaaatacaaccaacctactgaaagaaatagcttttaggatttcttctataagg
caatcccaaagtgtgatctatgtgaaaaacaaagttctgggaaaaaaacacaaagcaaaa

--------------------------------------------------------------------------------