--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13982 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1179       1236   0   Internal     58    86        Good
agcagtgaaactctgcatcgatcactaagacttcctggaagaggtcccagcgtgagtgtc
gcttctggcatctgtccttctggccagcctgtggtctggccaagtgatgtaaccctcctc
tccagcctgtgcacaggcagcctgggaacagctccatccccacccctcagctataaatag
GGCATCGTGACCCGGCCGGGGGAAGAAGCTGCCGTTGTTCTGGGTACTACAGCAGAAG
gtaagccgggggccccctcagctccttctcggtcttgtctctctcagatgtaactgagct
gtgggctaggaggaaaaggccgggaggaggcacggtgatgactgaaaaacctctcccctc
tcataagaccagtcatccggacgcgggctttcccccactcggtgcccacctggggtctta

Exon  2 +       5199       5327   1   Internal    129    87        Good
ccctgcaggctgtacagggcctgctagtggcccagggcagggctgatagccaggcccagc
tgctgctgtccacggtggtgggcgtgttcacagccccaggcctgcacctgaagcagccgt
ttgtgcagggcctggctctctatacccctgtggtcctcccacgctctctggacttcacag
AACTGGATGTTGCTGCTGAGAAGATTGACAGGTTCATGCAGGCTGTGACAGGATGGAAGA
CTGGCTGCTCCCTGATGGGAGCCAGTGTGGACAGCACCCTGGCTTTCAACACCTACGTCC
ACTTCCAAG
gtaaggcaaacctctctgctggctctggccctaggacttagtatccaatgtgtagctgag
atcagccagtcaggccttggagatgggcagggggcagccctgcggacatacctggtgacc
acccttgagaagtggggaagtggctgctccgctgggtccctggatgggccgtccacctcc

Exon  3 +       9122       9389   1   Internal    268    96   Excellent
aatatttgagccacacttgcggtcctgtggccaggagaatgcagagtggcctgggggggg
ccaaggaaggaggctgaggcagggcgaggggcaggatctgggcctttggtgtctgccagc
cctcattcctgcccctgtcttgggtgactcttccctccctgtctcctgtctggatttcag
GGAAGATGAAGGGCTTCTCCCTGCTGGCCGAGCCCCAGGAGTTCTGGGTGGACAACAGCA
CCTCAGTGTCTGTTCCCATGCTCTCTGGCATGGGCACCTTCCAGCACTGGAGTGACATCC
AGGACAACTTCTCGGTGACTCAAGTGCCCTTCACTGAGAGCGCCTGCCTGCTGCTGATCC
AGCCTCACTATGCCTCTGACCTGGACAAGGTGGAGGGTCTCACTTTCCAGCAAAACTCCC
TCAACTGGATGAAGAAACTATCTCCCCG
gtaggagcctcccggtctcccctggaatgtgggagccacactgtcctgcccaggctgggg
gcggggtggggagtagacacacctgagctgagccttgggtgcagagcagggcagggccgc
ggtggcacggggctgggcaggcggcctgtgtgtctgtctaccagtcctctatccagccag

Exon  4 +      10985      11129   2   Internal    145   100   Excellent
atttttattgtaggttttgctgaaattttccccaagggggaggatgacttagttgggtga
tggggggagcaaacatccctgtcgtcagggttgggtgcaaggagcataagcctgcctggc
ctctgggagagccctcactgtgtggcctggagccttcctaactgtgcatcatctccccag
GACCATCCACCTGACCATGCCCCAACTGGTGCTGCAAGGATCTTATGACCTGCAGGACCT
GCTCGCCCAGGCTGAGCTGCCCGCCATTCTGCACACCGAGCTGAACCTGCAAAAATTGAG
CAATGACCGCATCAGGGTGGGGGAG
gtatgtgtgagcctgtgtctgtgcctgacctgggttccaagtgtgcacagggtgggaggc
atggatgtaagggacacagaggaggctatgggtggggccagcagggcaagagggagcgga
gagtagggccaaaggtgggagagaagtagccagagcattctggggccttccaggtgcaga

Exon  5 +      11993      12181   0   Terminal    189    65    Marginal
acccttgcctacactgaggggcaggcatacactgtgcatcctcctggcaggctggaaaat
gtccccctccaggacagtgcacagcacagaggtcctgagcccaccccggccctctagccc
tcagcaccctgggtcacccagtgcgccctcagaatgatcctgatgtctgctgctttgcag
GTGCTGAACAGCATTTTTTTTGAGCTTGAAGCGGATGAGAGAGAGCCCACAGAGTCTACC
CAACAGCTTAACAAGCCTGAGGTCTTGGAGGTGACCCTGAACCGCCCATTCCTGTTTGCT
GTGTATGATCAAAGCGCCACTGCCCTGCACTTCCTGGGCCGCGTGGCCAACCCGCTGAGC
ACAGCATGA
ggccagggccccagaacacagtgcctggcaaggcctctgcccctggcctttgaggcaaag
gccagcagcagataacaaccccggacaaatcagcgatgtgtcacccccagtctcccacct
tttcttctaatgagtcgactttgagctggaaagcagccgtttctccttggtctaagtgtg

Exon  6 +      12671      12715   0   Terminal     45    55    Marginal
attccaaccgaccagcttgtttgtgaaacaaaaaagtgttcccttttcaagttgagaaca
aaaattgggttttaaaattaaagtatacatttttgcattgccttcggtttgtatttagtg
tcttgaatgtaagaacatgacctccgtgtagtgtctgtaataccttagttttttccacag
ATGCTTGTGATTTTTGAACAATACGTGAAAGATGCAAGCACCTGA
atttctgtttgaatgcggaaccatagctggttatttctcccttgtgttagtaataaacgt
cttgccacaataagcctccaaaaattttatctttcatttagcagccaaacagatgtatac
aattcagcagatagactgtgcaaacgaaagtgctttcctggactttggatggaatttcca

--------------------------------------------------------------------------------