--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11680 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (12 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1865       2020   0   Internal    156    64    Marginal
cccattgtgccgctctcctggctggtgtggctgcttctgctactgctggcctctctcctg
ccctcagcccggctggccagccccctcccccgggaggaggagatcgtgtttccagagaag
ctcaacggcagcgtcctgcctggctcgggcgcccctgccaggctgttgtgccgcttgcag
GCCTTTGGGGAGACGCTGCTACTAGAGCTGGAGCAGGACTCCGGTGTGCAGGTCGAGGGG
CTGACAGTGCAGTACCTGGGCCAGGCGCCTGAGCTGCTGGGTGGAGCAGAGCCTGGCACC
TACCTGACTGGCACCATCAATGGAGATCCGGAGTCG
gtggcatctctgcactgggatgggggagccctgttaggcgtgttacaatatcggggggct
gaactccacctccagcccctggagggaggcacccctaactctgctgggggacctggggct
cacatcctacgccggaagagtcctgccagcggtcaaggtcccatgtgcaacgtcaaggct

Exon  2 +       3133       3276   0   Internal    144    51    Marginal
cctccaaccacacagggcagacacgttgcagcccagccctctagccctggtcccataggc
cccagccacactcaggcctggagaaccccaaagtccctcctgacggcagtccaggctgct
ttcacctctggggctcccgcagccctgggatgtggcgtccccttctcctccccttcttag
AACCAGCTGCTGACTCCTCAGAGTTACCACAAAAGCCCTGAGATTTGGCGTTGGGGGAAG
GGCCCAACCAAGACCCGCCAGGAGTCAGGAATCCCGTGGGGTGTGTGGGGCCCAGCTGAC
TATGCTGAGTTCCAGACCCAGGAA
gtgagggattggagaatcgaccgacccatgggtctgagaggctatttcaggatcttcctc
tccctttttctctacagcgctttgcttcactgagtagatttgtggagacactggtggtgg
cagatgacaagatggccgcattccacggtgcggggctaaagcgctacctgctaacagtga

Exon  3 +       3354       3677   0   Internal    324    89        Good
gatttggcgttgggggaagggcccaaccaagacccgccaggagtcaggaatcccgtgggg
tgtgtggggcccagctgactatgctgagttccagacccaggaagtgagggattggagaat
cgaccgacccatgggtctgagaggctatttcaggatcttcctctccctttttctctacag
CGCTTTGCTTCACTGAGTAGATTTGTGGAGACACTGGTGGTGGCAGATGACAAGATGGCC
GCATTCCACGGTGCGGGGCTAAAGCGCTACCTGCTAACAGTGATGGCAGCAGCAGCCAAG
GCCTTCAAGCACCCAAGCATCCGCAATCCTGTCAGCTTGGTGGTGACTCGGCTAGTGATC
CTGGGGTCAGGCGAGGAGGGGCCCCAAGTGGGGCCCAGTGCTGCCCAGACCCTGCGCAGC
TTCTGTGCCTGGCAGCGGGGCCTCAACACCCCTGAGGACTCGGACCCTGACCACTTTGAC
ACAGCCATTCTGTTTACCCGTCAG
gtgaggccccagtcagcaccgcaggccatgcactgcacaattctaagaagcgccactaca
tagactatgatgcaaatgatgttcctggagttgtgtgacatggtgccttgccccagccac
actgccatgtgtggctacctaggccctgacagtgctgggtcctcagtgcccaggtccccg

Exon  4 +       3931       4087   0   Internal    157   100   Excellent
aaatgatgttcctggagttgtgtgacatggtgccttgccccagccacactgccatgtgtg
gctacctaggccctgacagtgctgggtcctcagtgcccaggtccccgggaatctggatct
caacccaatggacccaggtgtcttggctgtctatgcaccttctatgatccctctccacag
GACCTGTGTGGAGTCTCCACTTGCGACACGCTGGGTATGGCTGATGTGGGCACCGTCTGT
GACCCGGCTCGGAGCTGTGCCATTGTGGAGGATGATGGGCTCCAGTCAGCCTTCACTGCT
GCTCATGAACTGGGTAAAGTAGGGGTGGATGAGAAAG
gtattagggaggagaaggtgggggagggggtagcaagttcaccacagtgttaatgggggt
cccaaggtattcttcccccaggcctaggtatagggctattactcctctctgctccaggtg
tagacatacatttacatttttctattaaataaattagttggtcgaaactactgtgaactc

Exon  5 +       4599       4769   1   Internal    171   100   Excellent
cagagaaagagacggggctacatactgggagccctgagagtaccataaaggaaaggactg
ggggcagggtgaggtgggtaatggatctgatcatccacagctgcagccagatttattatg
gagtccctcagggcatggggaagggaccctcagatcctatcagggcctttgctcccacag
GTCATGTCTTCAACATGCTCCATGACAACTCCAAGCCATGCATCAGTTTGAATGGGCCTT
TGAGCACCTCTCGCCATGTCATGGCCCCTGTGATGGCTCATGTGGATCCTGAGGAGCCCT
GGTCCCCCTGCAGTGCCCGCTTCATCACTGACTTCCTGGACAATGGCTATG
gtaagcagatggcacttacctttccctgggtagcactcaattcctgtcctccagggcact
ctcacttccgctgcattctgcatggaccaaattgcctcccccaagtgtgcttcctctgca
gtgtgggaaggggtgagaaatgctgctgtctttgtgtagttctcacttcctcccagaata

Exon  6 +       6192       6299   0    Initial    108    77        Good
gggcactgtctcttagacaaaccagaggctccattgcatctgcctgtgactttccctggc
aaggactatgatgctgaccgccagtgccagctgaccttcgggcccgactcacgccattgt
ccacagctgccgccgccctgtgctgccctctggtgctctggccacctcaatggccatgcc
ATGTGCCAGACCAAACACTCGCCCTGGGCCGATGGCACACCCTGCGGGCCCGCACAGGCC
TGCATGGGTGGTCGCTGCCTCCACATGGACCAGCTCCAGGACTTCAAT
gtgagatcctagggcaggggtggggtaaagggcccgggggtgtggggactggccttaagc
ccaggagagagttcacttatgccccacttccgttctgtgcctttgcagattccacaggct
ggtggctggggtccttggggaccatggggtgactgctctcggacctgtgggggtggtgtc

Exon  7 +       6408       6594   0   Internal    187    75        Good
acaccctgcgggcccgcacaggcctgcatgggtggtcgctgcctccacatggaccagctc
caggacttcaatgtgagatcctagggcaggggtggggtaaagggcccgggggtgtgggga
ctggccttaagcccaggagagagttcacttatgccccacttccgttctgtgcctttgcag
ATTCCACAGGCTGGTGGCTGGGGTCCTTGGGGACCATGGGGTGACTGCTCTCGGACCTGT
GGGGGTGGTGTCCAGTTCTCCTCCCGAGACTGCACGAGGCCTGTCCCCCGGAATGGTGGC
AAGTACTGTGAGGGCCGCCGTACCCGCTTCCGCTCCTGCAACACTGAGGACTGCCCAACT
GGCTCAG
gtgaggagtaggggggatgggagcccttgggaggggacagtagagcaggaaggactgtcc
cttgagtgcaagaccaagggggtgttgattcccctgctgctgtggggagtgcctttaacc
tctgggaattgtccttggccgtctgcagggaagagcagagctgtgctgtctagagttctc

Exon  8 +       6846       7027   1   Internal    182   100   Excellent
gaccaagggggtgttgattcccctgctgctgtggggagtgcctttaacctctgggaattg
tccttggccgtctgcagggaagagcagagctgtgctgtctagagttctcaggggttgggt
ggagggatgtggggtgatgtgaggaaggaaggaggggctctgactgttttacccctccag
CCCTGACCTTCCGCGAGGAGCAGTGTGCTGCCTACAACCACCGCACCGACCTCTTCAAGA
GCTTCCCAGGGCCCATGGACTGGGTTCCTCGCTACACAGGCGTGGCCCCCCAGGACCAGT
GCAAACTCACCTGCCAGGCCCAGGCACTGGGCTACTACTATGTGCTGGAGCCACGGGTGA
GG
gtcaggacacccccaggccctgtctatggtcacacacacccgcagtgctccctctgcttt
ctgataacaaagatcacccaaagtaaccctgttcctacagccacgccagcccagtccagg
attccactcagacttatctgtacatgggtatcaggaaaacgagccccagactccagatat

Exon  9 +       7994       8169   0   Internal    176    97   Excellent
taattattattgttatgattatcacccacatggtggccggcactcacccatctacatccc
ctacttcatccaacttttccgacaacattgcttccctgatgggacatgggtctcgtttga
tttaccaaccccttttgacttaggaggaaccttcagcattgttctttctcttttcctcag
GTGGTAGATGGGACCCCCTGTTCCCCGGACAGCTCCTCGGTCTGTGTCCAGGGCCGATGC
ATCCATGCTGGCTGTGATCGCATCATTGGCTCCAAGAAGAAGTTTGACAAGTGCATGGTG
TGCGGAGGGGACGGTTCTGGTTGCAGCAAGCAGTCAGGCTCCTTCAGGAAATTCAG
gttctttcaccatcattcctccctctaccttcctggacattctgggtcctagtgatgcag
aggggaactcagcactgtttccactctcaaagagctcacagtctagcgggagatagacga
gtaggcagctacagtgcggtttcccatgtattcatccgaagttggaacagggtgttgtga

Exon 10 +       8670       8985   2   Internal    316    75        Good
ccagagataagaggcagtagggcacatgtgcatgtagctctgatccagaccgaacagctc
acataggattgggtgacagccatctacacacatgtacacacatacagtcacataagcaca
gctcagaaggctgaggggattcaggtgatcctgagctccccatctactccttccacacag
GTACGGATACAACAATGTGGTCACTATCCCCGCGGGGGCCACCCACATTCTTGTCCGGCA
GCAGGGAAACCCTGGCCACCGGAGCATCTACTTGGCCCTGAAGCTGCCAGATGGCTCCTA
TGCCCTCAATGGTGAATACACGCTGATGCCCTCCCCCACAGATGTGGTACTGCCTGGGGC
AGTCAGCTTGCGCTACAGCGGGGCCACTGCAGCCTCAGAGACACTGTCAGGCCATGGGCC
ACTGGCCCAGCCTTTGACACTGCAAGTCCTAGTGGCTGGCAACCCCCAGGACACACGCCT
CCGATACAGCTTCTTC
gtgccccggccgaccccttcaacgccacgccccactccccaggactggctgcaccgaaga
gcacagattctggagatccttcggcggcgcccctgggcgggcaggaaataacctcactat
cccggctgccctttctgggcaccggggcctcggacttagctgggagaaagagagagcttc

Exon 11 +      10717      10793   1   Terminal     77    52    Marginal
aaatttctgtccacatccactctccatatgcacttgaaggtggcaaagatccacaaccat
ggtgcctgcctttatcctcagggtccgttcctttggttggcagacccctatcctgggttc
tgagggaccaacagagaaaggaaaattccatccctcacctctggaagttcccaatcacag
GAAGGAAACATAGTAAGCACGTGGCTACAAATACAATTGACAAGAACATGAAGGTGCAGG
ATAACAAGAACAAATAA
caagaacaactgcatcaacacaaatgagtgcttagtaataagggtgatagttgaggggtc
tgggtttcacaacagtagaaagagcactggagtgggagccagcgggtctggattcaattt
ggggctcggcgtcttattagctgggtggtgttgggtaagtcactgatgctgagccttaga

Exon 12 +      11243      11294   0    Initial     52    46    Marginal
catggccatgtgagaggttacccctatgactacctgaagatggaacggagtctccagaat
ctgccagtgtaaacccagcagaatgcctagaagatgtgagattagaataaaatttcataa
aacaaaaacaatcgggcacggtggctcatgcctgtaatcccagcactttgggaggccgaa
ATGGGCGGATCACGAGGTCAGGAGATTGAGACCGACCATCCTGGCTACCACA
gtgaaaccccgtgtctactaaaaatacaaaatatatatatatatatatatatatattagc
cgggcatggtgacaggtgcctatagtcccagctacttgggagactgaggcaggagaatga
cttgcacccgggaggcagagcttacagtgagtcgagattgcgccactgcactccagcctg

--------------------------------------------------------------------------------